ID: 1171346790

View in Genome Browser
Species Human (GRCh38)
Location 20:24471183-24471205
Sequence GTGCTAGGCTGCGACCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346785_1171346790 -8 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346790 20:24471183-24471205 GTGCTAGGCTGCGACCTCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1171346783_1171346790 -1 Left 1171346783 20:24471161-24471183 CCCAGAGCCGGCCAACTTCTCCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1171346790 20:24471183-24471205 GTGCTAGGCTGCGACCTCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1171346778_1171346790 25 Left 1171346778 20:24471135-24471157 CCTGTGGGGTGAGCAGCCTCATA 0: 1
1: 0
2: 3
3: 16
4: 112
Right 1171346790 20:24471183-24471205 GTGCTAGGCTGCGACCTCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1171346780_1171346790 9 Left 1171346780 20:24471151-24471173 CCTCATAGCCCCCAGAGCCGGCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1171346790 20:24471183-24471205 GTGCTAGGCTGCGACCTCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1171346781_1171346790 1 Left 1171346781 20:24471159-24471181 CCCCCAGAGCCGGCCAACTTCTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1171346790 20:24471183-24471205 GTGCTAGGCTGCGACCTCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1171346782_1171346790 0 Left 1171346782 20:24471160-24471182 CCCCAGAGCCGGCCAACTTCTCC 0: 1
1: 0
2: 3
3: 16
4: 147
Right 1171346790 20:24471183-24471205 GTGCTAGGCTGCGACCTCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 47
1171346784_1171346790 -2 Left 1171346784 20:24471162-24471184 CCAGAGCCGGCCAACTTCTCCGT 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1171346790 20:24471183-24471205 GTGCTAGGCTGCGACCTCAAGGG 0: 1
1: 0
2: 0
3: 3
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346790 Original CRISPR GTGCTAGGCTGCGACCTCAA GGG Intronic
900472423 1:2861396-2861418 GTGCAAGGCTGGGACCACACAGG - Intergenic
922344538 1:224685239-224685261 GTGACACGCTGCAACCTCAAAGG - Intronic
1062846505 10:711336-711358 GTGCGAGGCTGGGAACCCAAAGG - Intergenic
1072309505 10:94141090-94141112 GTGCTAGGCTGCTACATTAAAGG + Intronic
1075207659 10:120461117-120461139 ATGCTAGGATGACACCTCAAAGG + Intronic
1077955323 11:7013178-7013200 GTGATAGGATGTGACCTCCAAGG - Intronic
1084634666 11:70383463-70383485 GAGCTAGGCTGCGTCCGTAAAGG - Exonic
1098993898 12:77096178-77096200 CTGCTAGGCTGCTGCCTCACAGG + Intergenic
1104206337 12:126642442-126642464 GTGCCAGGCTGCAGCCTCACAGG + Intergenic
1118308855 14:64677905-64677927 GTGCTAGGCTGTGAGCTCCTCGG + Intergenic
1122783143 14:104152191-104152213 GTGCGAGGCTGGGGCCTCCATGG - Exonic
1129870388 15:78936485-78936507 GTCCTAGCCTGTGACCTCCAGGG - Intronic
1130703673 15:86211562-86211584 CTGCAAGGCTGCTACCTCACAGG + Intronic
1133654126 16:7843207-7843229 GTGTTAGGCAGCTGCCTCAAGGG - Intergenic
1135352430 16:21740198-21740220 ATGCTGGGCTGCAAACTCAAAGG + Intronic
1135450918 16:22556320-22556342 ATGCTGGGCTGCAAACTCAAAGG + Intergenic
1139526330 16:67518927-67518949 GGTCTCGGCTGAGACCTCAAGGG + Intronic
1144909729 17:18671433-18671455 GTGCTGGCCTGAGACATCAAGGG + Intronic
1149616042 17:58000017-58000039 GTGCTAGGCTGGGATTTCAGGGG - Intronic
1150828125 17:68494574-68494596 GTGCTGTGCTGGGACTTCAAGGG + Intergenic
1155464693 18:26121252-26121274 GGGGTAGGCTGCTACCTCAATGG + Intergenic
1158256181 18:55551484-55551506 GAGCCAGGCTTCAACCTCAACGG + Intronic
1166551441 19:43668614-43668636 GGGCTGGGCTAGGACCTCAAGGG - Intronic
925702828 2:6656110-6656132 GTGCTTGCCTGGAACCTCAAGGG - Intergenic
928579566 2:32693407-32693429 GTTCTTGGCTCCAACCTCAAAGG - Intronic
932266509 2:70371692-70371714 GTGTCAGGCTGCGACCACTAAGG + Intergenic
939977277 2:148732702-148732724 GTGGTTGGCTACTACCTCAAGGG - Intronic
940511709 2:154623818-154623840 GTGCTAGGCAAAGACCTCATTGG + Intergenic
1171346790 20:24471183-24471205 GTGCTAGGCTGCGACCTCAAGGG + Intronic
1171443520 20:25186574-25186596 CTGCTAGGCTGCTGCCTCACAGG + Intergenic
1175178302 20:57127094-57127116 GTGCTAACCTGTGACCCCAAAGG + Intergenic
1175905405 20:62377056-62377078 GTCCTAGGCTGCGAGCTCCCTGG + Intergenic
1178127741 21:29533795-29533817 GGGAGAGGCTGGGACCTCAAAGG - Intronic
1179594973 21:42437388-42437410 GTGGTAGGCAGGGTCCTCAAAGG - Intronic
1180727908 22:17960241-17960263 GTGCTAGGCAGTGAGCTCACTGG + Intronic
1183479720 22:38056958-38056980 GGGATGGGCTGGGACCTCAAAGG + Intronic
950682214 3:14593132-14593154 GTGCTGGGCTGAGACCCCAGCGG - Intergenic
966684760 3:182682345-182682367 GTGCTGGGCGGCGACCTCCGCGG - Intergenic
978744339 4:112174710-112174732 GTGCTAGGCTGCACCCTCTCAGG + Intronic
982736899 4:159016638-159016660 CAGCTAGGCTGCAACCACAAGGG - Intronic
986800506 5:11255584-11255606 ATACTTGGCTGCGACCACAAAGG + Intronic
1006459641 6:34150918-34150940 GTGGTAGGCTGGGTGCTCAATGG + Intronic
1013283939 6:108664304-108664326 GTGCTGGCCTGAGACATCAAGGG - Exonic
1019559052 7:1646921-1646943 GTGCTTGGCTCTGACCTCAGCGG + Intergenic
1038499991 8:28035753-28035775 GTGCTAGGCAGCCACCACAGTGG - Intronic
1061801304 9:133114747-133114769 GTGCTTGGCTGTGTCCTCAAGGG + Intronic
1062076729 9:134593825-134593847 ATGCAAGGCTGAGTCCTCAAAGG - Intergenic
1062419124 9:136470926-136470948 GCGCTAGGCTGCGCCTTCCAGGG - Intronic
1189136168 X:38552391-38552413 GTGCTAAGCTTAGGCCTCAAGGG - Intronic
1193281519 X:79656182-79656204 TTGCTAGGCTGCTGCCTCACTGG + Intergenic
1202048369 Y:20756443-20756465 GTGCTGGGCTGCGGAGTCAAGGG - Intronic