ID: 1171346791

View in Genome Browser
Species Human (GRCh38)
Location 20:24471195-24471217
Sequence GACCTCAAGGGCTGCCGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346787_1171346791 0 Left 1171346787 20:24471172-24471194 CCAACTTCTCCGTGCTAGGCTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1171346791 20:24471195-24471217 GACCTCAAGGGCTGCCGCGTCGG No data
1171346785_1171346791 4 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346791 20:24471195-24471217 GACCTCAAGGGCTGCCGCGTCGG No data
1171346781_1171346791 13 Left 1171346781 20:24471159-24471181 CCCCCAGAGCCGGCCAACTTCTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1171346791 20:24471195-24471217 GACCTCAAGGGCTGCCGCGTCGG No data
1171346788_1171346791 -9 Left 1171346788 20:24471181-24471203 CCGTGCTAGGCTGCGACCTCAAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1171346791 20:24471195-24471217 GACCTCAAGGGCTGCCGCGTCGG No data
1171346784_1171346791 10 Left 1171346784 20:24471162-24471184 CCAGAGCCGGCCAACTTCTCCGT 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1171346791 20:24471195-24471217 GACCTCAAGGGCTGCCGCGTCGG No data
1171346782_1171346791 12 Left 1171346782 20:24471160-24471182 CCCCAGAGCCGGCCAACTTCTCC 0: 1
1: 0
2: 3
3: 16
4: 147
Right 1171346791 20:24471195-24471217 GACCTCAAGGGCTGCCGCGTCGG No data
1171346780_1171346791 21 Left 1171346780 20:24471151-24471173 CCTCATAGCCCCCAGAGCCGGCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1171346791 20:24471195-24471217 GACCTCAAGGGCTGCCGCGTCGG No data
1171346783_1171346791 11 Left 1171346783 20:24471161-24471183 CCCAGAGCCGGCCAACTTCTCCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1171346791 20:24471195-24471217 GACCTCAAGGGCTGCCGCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346791 Original CRISPR GACCTCAAGGGCTGCCGCGT CGG Intronic
No off target data available for this crispr