ID: 1171346792

View in Genome Browser
Species Human (GRCh38)
Location 20:24471196-24471218
Sequence ACCTCAAGGGCTGCCGCGTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 2, 3: 3, 4: 60}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346787_1171346792 1 Left 1171346787 20:24471172-24471194 CCAACTTCTCCGTGCTAGGCTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1171346792 20:24471196-24471218 ACCTCAAGGGCTGCCGCGTCGGG 0: 1
1: 0
2: 2
3: 3
4: 60
1171346780_1171346792 22 Left 1171346780 20:24471151-24471173 CCTCATAGCCCCCAGAGCCGGCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1171346792 20:24471196-24471218 ACCTCAAGGGCTGCCGCGTCGGG 0: 1
1: 0
2: 2
3: 3
4: 60
1171346781_1171346792 14 Left 1171346781 20:24471159-24471181 CCCCCAGAGCCGGCCAACTTCTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1171346792 20:24471196-24471218 ACCTCAAGGGCTGCCGCGTCGGG 0: 1
1: 0
2: 2
3: 3
4: 60
1171346785_1171346792 5 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346792 20:24471196-24471218 ACCTCAAGGGCTGCCGCGTCGGG 0: 1
1: 0
2: 2
3: 3
4: 60
1171346788_1171346792 -8 Left 1171346788 20:24471181-24471203 CCGTGCTAGGCTGCGACCTCAAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1171346792 20:24471196-24471218 ACCTCAAGGGCTGCCGCGTCGGG 0: 1
1: 0
2: 2
3: 3
4: 60
1171346783_1171346792 12 Left 1171346783 20:24471161-24471183 CCCAGAGCCGGCCAACTTCTCCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1171346792 20:24471196-24471218 ACCTCAAGGGCTGCCGCGTCGGG 0: 1
1: 0
2: 2
3: 3
4: 60
1171346784_1171346792 11 Left 1171346784 20:24471162-24471184 CCAGAGCCGGCCAACTTCTCCGT 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1171346792 20:24471196-24471218 ACCTCAAGGGCTGCCGCGTCGGG 0: 1
1: 0
2: 2
3: 3
4: 60
1171346782_1171346792 13 Left 1171346782 20:24471160-24471182 CCCCAGAGCCGGCCAACTTCTCC 0: 1
1: 0
2: 3
3: 16
4: 147
Right 1171346792 20:24471196-24471218 ACCTCAAGGGCTGCCGCGTCGGG 0: 1
1: 0
2: 2
3: 3
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346792 Original CRISPR ACCTCAAGGGCTGCCGCGTC GGG Intronic
900408414 1:2502389-2502411 ACCTCGGGGGCTGCCGCTGCCGG - Exonic
902440393 1:16425607-16425629 ACCTGAAGGGCTGCAGCAGCTGG - Intronic
905009141 1:34735327-34735349 ACCTAAAGGGCTGCATCATCTGG + Intronic
905449679 1:38048079-38048101 TCCTCAAGGGCTGGGGCGTGAGG - Intergenic
910757315 1:90707021-90707043 ACCTGCAGGGCTGCTGCCTCGGG + Intergenic
914665864 1:149832170-149832192 ACCTCAAGAGCGGCGGCGCCAGG - Intergenic
914669901 1:149861624-149861646 ACCTCAAGAGCGGCGGCGCCAGG + Intronic
1063639840 10:7818605-7818627 TCCTCTAGGGCTTCCGCGGCGGG - Exonic
1070812597 10:79305854-79305876 GCCTCAAGGGCTCCCTCGTGGGG - Intronic
1083448449 11:62726795-62726817 GCCTCCATGGCTGCCGCCTCCGG + Exonic
1084411777 11:69009900-69009922 ATCTCCAGGCCTGGCGCGTCTGG + Exonic
1084545202 11:69811941-69811963 CCCTCAAGGGCTGCCTCATGGGG + Intronic
1095943079 12:47738991-47739013 ACCTCAAGTGCTGATGCCTCAGG - Intronic
1096678751 12:53241152-53241174 ACCTCCAGAGCTGCTGCTTCAGG - Intergenic
1098105923 12:67069191-67069213 TCCTCTAGGGCAGCCGCGCCGGG + Intergenic
1101641280 12:106587098-106587120 CCATCAAGGGCTGCAGCCTCGGG - Intronic
1104924993 12:132309332-132309354 ACCTCCAGGGCGGCTGCGTGAGG - Intronic
1136777394 16:32879199-32879221 ACCTCCTGGGCTGCCTCCTCAGG - Intergenic
1136893231 16:33982314-33982336 ACCTCCTGGGCTGCCTCCTCAGG + Intergenic
1137735200 16:50718748-50718770 ACATGAAGGGCTGCACCGTCTGG + Intronic
1203079807 16_KI270728v1_random:1141308-1141330 ACCTCCTGGGCTGCCTCCTCAGG - Intergenic
1148344489 17:46894503-46894525 CCCTCAAGGGCTGTAGGGTCGGG - Intergenic
1152356799 17:79811486-79811508 GCCTCTAGGGCTGCCGCCTGCGG + Intergenic
1152886002 17:82849856-82849878 GCCTCAAGAGCTGCCGCGCACGG - Intronic
1152941201 17:83173628-83173650 ACCTAGAGTGCTGCCACGTCTGG + Intergenic
1152941294 17:83174017-83174039 ACCTCAAGGGCCGCCTCGTCGGG - Intergenic
1161721230 19:5903754-5903776 AGCGCAAGGGCAGCCGCGGCTGG + Exonic
1167278215 19:48551698-48551720 CCCTCACGGGCTGACGCGTAAGG - Intergenic
926095799 2:10080129-10080151 CCCTCCAGGGCTGCCGCTCCGGG + Exonic
932887585 2:75561070-75561092 ACCTGAACGGCTGCGGCGTGCGG + Intronic
935594348 2:104867722-104867744 ACTTCAGGGCCTGCCTCGTCAGG - Intergenic
937631676 2:124109090-124109112 ACCTCACTGGCTGCCGGCTCAGG - Intronic
942855447 2:180540953-180540975 GTCTCCAAGGCTGCCGCGTCTGG - Intergenic
1171346792 20:24471196-24471218 ACCTCAAGGGCTGCCGCGTCGGG + Intronic
1172041985 20:32052407-32052429 ACCTCAGGGGCTGCCGAGCTGGG + Exonic
1184258506 22:43301187-43301209 CCCTCCAGGGCTGCCACGGCTGG + Intronic
1184684020 22:46087948-46087970 ACCTCCAGGGCTGCAGCTGCAGG + Intronic
949862954 3:8523019-8523041 CCCTGAAGGGCTGCCGATTCAGG + Intronic
952958330 3:38574483-38574505 ACCTCCAGGGTTGCCCCATCTGG - Intronic
953667079 3:44933247-44933269 ACCTCACGGGCTCCCGGGACAGG + Intronic
961402975 3:126660174-126660196 ACCGCCAGGGCTGCAGCGGCAGG + Intergenic
969610017 4:8222329-8222351 ACCTCAAGGGGTGCCTTGTCTGG - Intronic
972195718 4:36651420-36651442 TCCTCAAGGGTTGCCAAGTCAGG + Intergenic
990948612 5:61275207-61275229 AGCTCAGGGGCTGAAGCGTCTGG - Intergenic
998372902 5:141672602-141672624 AACTGCAGGGCTGCAGCGTCCGG - Exonic
1002350112 5:178577378-178577400 TCCCCAAGGGCGGCCGCATCCGG + Intronic
1003425557 6:5996236-5996258 TCCTCTAGGGCGGCCCCGTCTGG + Intergenic
1005003496 6:21265654-21265676 ACCTCAAGGGCTACCTGGCCTGG + Intergenic
1006506281 6:34490814-34490836 AACGCCAGGGCTGCCGTGTCAGG - Intronic
1014903690 6:127001163-127001185 ACCTCAAGGGCTGACACCCCTGG - Intergenic
1014947336 6:127514808-127514830 ACCTCAAGGTCTGCGGCGCGGGG - Exonic
1019422880 7:959107-959129 ACCTCCCGGGGTCCCGCGTCGGG - Intronic
1021301322 7:18976418-18976440 ACCTCAAGGACAGCCACGTAAGG - Intronic
1033597496 7:142867776-142867798 ACCTCAAGTCCTGCCAAGTCTGG + Intronic
1035457129 7:159015909-159015931 ACCTCAAGGCCTGCGGAGTGTGG + Intergenic
1035663566 8:1364354-1364376 TCGTCAAGGGCTGCCACGTGCGG + Intergenic
1037723670 8:21466124-21466146 ACCTCAAGGGCTGCCACGTGAGG + Intergenic
1041746293 8:61212205-61212227 ACCACCAGGGCTGCAGCGTCTGG + Intronic
1042862849 8:73331162-73331184 TCCTCAAGGGCCTCCGCTTCAGG - Intergenic
1049106969 8:140620122-140620144 ACCTGAAGGGGTCCCACGTCAGG + Intronic
1049918275 9:339454-339476 ACCTCCAGGGCTGCCGAGTGAGG - Intronic
1060828798 9:126701150-126701172 ACCTCAAGCCCTCCCGCCTCCGG - Intergenic
1062029763 9:134356925-134356947 ACCTCCAGGGCTGCTGAGGCTGG - Intronic
1062513646 9:136921447-136921469 ACCTCGAGGGCTGGCACGGCAGG - Intronic
1194833125 X:98649941-98649963 ATCTTAAGGGCTGCAGTGTCTGG + Intergenic
1200102460 X:153694846-153694868 ACCTCCTGGGCTGCCTCCTCAGG + Exonic