ID: 1171346794

View in Genome Browser
Species Human (GRCh38)
Location 20:24471197-24471219
Sequence CCTCAAGGGCTGCCGCGTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 51}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346781_1171346794 15 Left 1171346781 20:24471159-24471181 CCCCCAGAGCCGGCCAACTTCTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1171346794 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 51
1171346782_1171346794 14 Left 1171346782 20:24471160-24471182 CCCCAGAGCCGGCCAACTTCTCC 0: 1
1: 0
2: 3
3: 16
4: 147
Right 1171346794 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 51
1171346787_1171346794 2 Left 1171346787 20:24471172-24471194 CCAACTTCTCCGTGCTAGGCTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1171346794 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 51
1171346780_1171346794 23 Left 1171346780 20:24471151-24471173 CCTCATAGCCCCCAGAGCCGGCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1171346794 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 51
1171346783_1171346794 13 Left 1171346783 20:24471161-24471183 CCCAGAGCCGGCCAACTTCTCCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1171346794 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 51
1171346788_1171346794 -7 Left 1171346788 20:24471181-24471203 CCGTGCTAGGCTGCGACCTCAAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1171346794 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 51
1171346784_1171346794 12 Left 1171346784 20:24471162-24471184 CCAGAGCCGGCCAACTTCTCCGT 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1171346794 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 51
1171346785_1171346794 6 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346794 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 9
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346794 Original CRISPR CCTCAAGGGCTGCCGCGTCG GGG Intronic
900537693 1:3187030-3187052 CCTCAAGGCCAGTCACGTCGTGG - Intronic
901052136 1:6430553-6430575 CCTCAGGGGCTGCTGCCACGCGG + Intronic
902336856 1:15758960-15758982 CCTCCAGGGGCGCCGCGCCGGGG - Intronic
905453734 1:38073631-38073653 CCTCAAGGGCTGATGAGACGAGG + Intergenic
916061050 1:161098778-161098800 CGTCCACGGGTGCCGCGTCGTGG - Exonic
920594101 1:207251145-207251167 CCTCAAGGGCTGCTACCTCCTGG - Intergenic
923046137 1:230356998-230357020 CCTCAAGTACTTCCACGTCGTGG - Exonic
1063393213 10:5663642-5663664 CTCCCAGGGCTGCCGAGTCGAGG + Intronic
1063639838 10:7818604-7818626 CCTCTAGGGCTTCCGCGGCGGGG - Exonic
1076464108 10:130666610-130666632 CCTCAAGGGCTGCCCCTTCTTGG - Intergenic
1083448451 11:62726796-62726818 CCTCCATGGCTGCCGCCTCCGGG + Exonic
1084702464 11:70796341-70796363 CCTGGAGGGCTGCTGCGTAGGGG - Intronic
1092204465 12:6606903-6606925 CCTCAAGAGCTGCGGGGACGAGG + Intronic
1098105925 12:67069192-67069214 CCTCTAGGGCAGCCGCGCCGGGG + Intergenic
1101641279 12:106587097-106587119 CATCAAGGGCTGCAGCCTCGGGG - Intronic
1120890750 14:89488829-89488851 CCTCAGGGGCTGTCGAGGCGTGG - Intronic
1126885313 15:53142671-53142693 ACTCGAGGGCTGCCCCATCGAGG - Intergenic
1148156867 17:45429727-45429749 CTTCAAGGCCTGCAGCGTGGCGG - Intronic
1148344487 17:46894502-46894524 CCTCAAGGGCTGTAGGGTCGGGG - Intergenic
1150388575 17:64778501-64778523 CTTCAAGGCCTGCAGCGTAGCGG - Intergenic
1150724461 17:67640311-67640333 CCTCAGCAGCTGCCGCATCGCGG + Intronic
1152356801 17:79811487-79811509 CCTCTAGGGCTGCCGCCTGCGGG + Intergenic
1152886000 17:82849855-82849877 CCTCAAGAGCTGCCGCGCACGGG - Intronic
1152941292 17:83174016-83174038 CCTCAAGGGCCGCCTCGTCGGGG - Intergenic
1161621036 19:5297173-5297195 CCCCAAGGGCAGCCGCCTCCTGG - Intronic
1163372093 19:16906988-16907010 CCTCAGGGGCTGCCGGGCTGCGG + Exonic
1167278213 19:48551697-48551719 CCTCACGGGCTGACGCGTAAGGG - Intergenic
925020132 2:562587-562609 CCTGTGGGGCTGCCGCGTAGGGG + Intergenic
925048879 2:795908-795930 ACTCCAGCGCAGCCGCGTCGGGG + Intergenic
936104833 2:109614843-109614865 ACTCCGGGGCCGCCGCGTCGGGG - Exonic
938422305 2:131155058-131155080 TCTCAAGGGCTCCCGCGGTGTGG - Intronic
942083908 2:172427404-172427426 CCTCCGGGGCTCCCACGTCGTGG + Intronic
1170533328 20:17315780-17315802 CCTGCAGGGCTGCGGCGTCCTGG + Intronic
1171123613 20:22584536-22584558 GCTCACGGGCTGCCGGGTGGCGG + Intronic
1171154919 20:22863029-22863051 CCTCAAGAGCTGCCGTGGCCAGG + Intergenic
1171346794 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG + Intronic
1172041987 20:32052408-32052430 CCTCAGGGGCTGCCGAGCTGGGG + Exonic
1183753613 22:39738163-39738185 CCTCAGGGGATGCTGCGTGGAGG - Intergenic
1184258508 22:43301188-43301210 CCTCCAGGGCTGCCACGGCTGGG + Intronic
950439459 3:13000686-13000708 CCTCAAGGGCTGCCCTGCTGGGG + Intronic
950660996 3:14466987-14467009 CCACAAGGGCTGCTGCATCCTGG + Intronic
955291078 3:57692919-57692941 CCACAAGGGCCGGCGCCTCGCGG + Exonic
985970786 5:3376895-3376917 CCTCAAGGGCTGTGGCCTGGAGG + Intergenic
996404167 5:123090116-123090138 GCTCAAGGGCAGCGGCGCCGCGG + Exonic
997294412 5:132760822-132760844 CCTCAGGGGCTGCTGCGAGGTGG + Exonic
1003425559 6:5996237-5996259 CCTCTAGGGCGGCCCCGTCTGGG + Intergenic
1014947334 6:127514807-127514829 CCTCAAGGTCTGCGGCGCGGGGG - Exonic
1018786059 6:167108768-167108790 CCTCGAGGGCTGCAGGGTGGGGG + Intergenic
1034469069 7:151246124-151246146 CCTGAAGGGCTGCCTCCTGGGGG + Intronic
1035297121 7:157873530-157873552 CCTCAAGGTCTGTCTCGTCGTGG + Intronic
1035297131 7:157873576-157873598 CCTCAAGGTCTGTCTCGTCGTGG + Intronic
1035297141 7:157873622-157873644 CCTCAAGGTCTGTCTCGTCGTGG + Intronic
1035297151 7:157873668-157873690 CCTCAAGGTCTGTCTCGTCGTGG + Intronic
1040881797 8:52213391-52213413 CCTAAAGGGCTGCAGGGTCACGG + Intronic
1041746295 8:61212206-61212228 CCACCAGGGCTGCAGCGTCTGGG + Intronic
1054848494 9:69821575-69821597 CCTCCAGGGCTGCCACTTCCTGG + Intronic
1058311939 9:103514874-103514896 CCTGAAGTCCTGCCGCGTGGTGG + Intergenic
1062254930 9:135616404-135616426 ACTCAAGGGCAGCCTCGTCCTGG - Intergenic
1062535348 9:137018779-137018801 CTTCAAGGGCTTCCCCGACGAGG - Exonic
1190311123 X:49117643-49117665 CCTCAAGGGCTGGTGCCTGGAGG - Exonic
1196438549 X:115696190-115696212 CCTTAAGGGCTGCTGCTTGGTGG - Intergenic
1199793786 X:151177265-151177287 CCGCAAGGGCGGCCGCGCTGAGG + Intronic