ID: 1171346795

View in Genome Browser
Species Human (GRCh38)
Location 20:24471202-24471224
Sequence AGGGCTGCCGCGTCGGGGAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 78}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346785_1171346795 11 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346795 20:24471202-24471224 AGGGCTGCCGCGTCGGGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 78
1171346781_1171346795 20 Left 1171346781 20:24471159-24471181 CCCCCAGAGCCGGCCAACTTCTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1171346795 20:24471202-24471224 AGGGCTGCCGCGTCGGGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 78
1171346782_1171346795 19 Left 1171346782 20:24471160-24471182 CCCCAGAGCCGGCCAACTTCTCC 0: 1
1: 0
2: 3
3: 16
4: 147
Right 1171346795 20:24471202-24471224 AGGGCTGCCGCGTCGGGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 78
1171346783_1171346795 18 Left 1171346783 20:24471161-24471183 CCCAGAGCCGGCCAACTTCTCCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1171346795 20:24471202-24471224 AGGGCTGCCGCGTCGGGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 78
1171346788_1171346795 -2 Left 1171346788 20:24471181-24471203 CCGTGCTAGGCTGCGACCTCAAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1171346795 20:24471202-24471224 AGGGCTGCCGCGTCGGGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 78
1171346780_1171346795 28 Left 1171346780 20:24471151-24471173 CCTCATAGCCCCCAGAGCCGGCC 0: 1
1: 0
2: 0
3: 16
4: 197
Right 1171346795 20:24471202-24471224 AGGGCTGCCGCGTCGGGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 78
1171346787_1171346795 7 Left 1171346787 20:24471172-24471194 CCAACTTCTCCGTGCTAGGCTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1171346795 20:24471202-24471224 AGGGCTGCCGCGTCGGGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 78
1171346784_1171346795 17 Left 1171346784 20:24471162-24471184 CCAGAGCCGGCCAACTTCTCCGT 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1171346795 20:24471202-24471224 AGGGCTGCCGCGTCGGGGATCGG 0: 1
1: 0
2: 0
3: 5
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346795 Original CRISPR AGGGCTGCCGCGTCGGGGAT CGG Intronic
900579839 1:3403513-3403535 AGGGCTGGTGCCTTGGGGATAGG - Intronic
901626932 1:10629896-10629918 AGGACCGCCGGGGCGGGGATGGG + Exonic
901934495 1:12618248-12618270 CGGGCAGCCGCGTCGCGGAGAGG + Intergenic
903357298 1:22756100-22756122 AGGGCTTCTGGGGCGGGGATGGG + Intronic
908356719 1:63329897-63329919 AGTGCTGTCGTGTCGGGGATCGG + Intergenic
915108126 1:153546874-153546896 GGGGCTGCGGCTTCAGGGATAGG + Intronic
918238231 1:182600223-182600245 GGGGCAGCCACCTCGGGGATGGG + Exonic
920055323 1:203186745-203186767 TGGTTTGCCGCGTCGGGGAGTGG - Exonic
1063639837 10:7818599-7818621 AGGGCTTCCGCGGCGGGGAAAGG - Exonic
1067343569 10:45422433-45422455 AGGGCTGCCTCCTCAGGGGTGGG + Intronic
1070314188 10:75295095-75295117 AGGGCTGCGGCGGCCGGGAGGGG + Intergenic
1073062119 10:100739300-100739322 AGGGCCGCCGAGGCGGGGACAGG - Intronic
1074830164 10:117241959-117241981 CAGGCTGCCGCGCCGGGGCTAGG + Intronic
1092474888 12:8810042-8810064 AGGGCTGCTTCGTGCGGGATTGG - Intergenic
1103952152 12:124557156-124557178 CTGGCTGCCACGTGGGGGATGGG + Intronic
1110568599 13:76980324-76980346 AGCGCTGGCGCGTTGGCGATGGG + Intergenic
1113857842 13:113458514-113458536 AGGGCTGCCGGGGTGGGGAAGGG - Intronic
1120169488 14:81234494-81234516 AGGGCTGGGGGGTGGGGGATGGG + Intergenic
1122620986 14:103057553-103057575 TGGGCCGCCGGGTCGGGGCTGGG - Intergenic
1123017515 14:105382409-105382431 AGGGCTGGCGTGGTGGGGATGGG + Intronic
1123162244 14:106289553-106289575 AGAGCTGCAGGGTCGGGGCTGGG + Intergenic
1135036542 16:19082939-19082961 AGGGCTGGAGGGGCGGGGATGGG + Intergenic
1136073778 16:27804759-27804781 AGGGCTGCAGAGACTGGGATTGG + Intronic
1136073812 16:27804858-27804880 AGGGCTGCAGGGACTGGGATTGG + Intronic
1138410168 16:56833132-56833154 AGGGCTGCTGCCTGGGGGTTGGG + Intronic
1139390504 16:66604496-66604518 AGGGGTGCCGGGGCGGTGATCGG + Intronic
1142112222 16:88339047-88339069 AGGGCTGCTGCGTCCTGGAGGGG + Intergenic
1142287813 16:89178561-89178583 AGGGCTGCCTCGGTGGGGCTGGG - Intronic
1142367350 16:89657293-89657315 AGGGGTTCCGGGTCGGGTATCGG + Intronic
1142762869 17:2051672-2051694 AGGGCTGTGGCGTCGGGGGCCGG + Intergenic
1143611255 17:8019221-8019243 AGGGCTGCAGGGTCGGGTACGGG - Intronic
1143766125 17:9138751-9138773 AGGGCTGGGGAGTGGGGGATTGG + Intronic
1148323573 17:46771334-46771356 AGGGCTGGGGCGTCTAGGATTGG - Intronic
1158839466 18:61368422-61368444 AGGACTGCTGGGTCGGGGGTGGG + Intronic
1158893461 18:61893853-61893875 CGGGCGGCCGCGGCGGGGAGCGG - Intronic
1160404670 18:78637607-78637629 AGGGCTGCCTCGCCAGGGACGGG + Intergenic
1160706218 19:531502-531524 ACGGCGGCGGCCTCGGGGATCGG + Intergenic
1161160064 19:2756950-2756972 GGGGCTGCCACCTCGGGGGTGGG - Intronic
1161207202 19:3047270-3047292 GGGGCGGCCGCGGCGGGGAGGGG + Intronic
1161500196 19:4610289-4610311 AGGGCTTCTGCGGCGGGGAGGGG + Intergenic
1161519144 19:4713889-4713911 AGGGCTGCCGCGGGGTGGGTGGG - Intronic
1165450606 19:35879922-35879944 AGGGCTGGCGCGCCGGGGGCGGG + Intergenic
1165601283 19:37057251-37057273 AGGCCTGCCCGGACGGGGATCGG + Intronic
1166219135 19:41353909-41353931 AGGGCGGCGGCGGCGGGGACCGG + Exonic
1166734499 19:45076138-45076160 AGGGCGGCCCCGGCGGGCATGGG + Exonic
925406491 2:3608800-3608822 AGGGCAGCCCCGCCGTGGATGGG + Intronic
930768420 2:55108418-55108440 GGGGCTCCAGCATCGGGGATGGG + Intronic
948125438 2:235561524-235561546 AGGGCTGAAGAGTTGGGGATGGG + Intronic
948839696 2:240642816-240642838 GGGGCTGCCGCCTCTGGGACTGG + Intergenic
1169071532 20:2735355-2735377 AGGGCTGGGGAGTAGGGGATGGG + Intronic
1171346795 20:24471202-24471224 AGGGCTGCCGCGTCGGGGATCGG + Intronic
1176019821 20:62956941-62956963 TGGGCGGCCACCTCGGGGATCGG + Exonic
1176418993 21:6499271-6499293 AGCGCTGCCACGTCGGGGCGGGG - Intergenic
1178914672 21:36699665-36699687 CGGGCTGCGGCGGCGGGGATGGG - Exonic
1179023118 21:37657240-37657262 AGGGCTGCAGAGCTGGGGATGGG + Intronic
1179694486 21:43107593-43107615 AGCGCTGCCACGTCGGGGCGGGG - Intergenic
1181813762 22:25421354-25421376 GGGGCGGCGGCGTCGGGGACCGG - Intergenic
1184322104 22:43749705-43749727 AGGTCTGCAGCCTGGGGGATGGG + Intronic
954451336 3:50573276-50573298 GGGGCTGCCCCATCTGGGATTGG + Intronic
955281234 3:57596947-57596969 AGGGGCGCCGGGTCGGGGGTCGG - Intronic
966207934 3:177423687-177423709 AGGGCTGCAGGTTTGGGGATGGG + Intergenic
969249118 4:5955558-5955580 ACAGCTGCCGCGTGGTGGATGGG + Intronic
969428801 4:7140981-7141003 AGGGCTGCCTCGTCCTGGGTGGG + Intergenic
978619311 4:110622847-110622869 AGGGCTGCCGCGTGGGGGGGGGG - Exonic
978753343 4:112276620-112276642 AGGGCTGGGGAGTCGGGGTTAGG + Exonic
986777518 5:11031389-11031411 AGGGCTGAGGGGTGGGGGATGGG + Intronic
997732764 5:136192905-136192927 TGGGCTGCGGCGGCGGGGAGAGG + Intergenic
999673778 5:153979254-153979276 AGGGCTGCCACTTCGGGTATAGG - Intergenic
1000935158 5:167298146-167298168 AGGGCTGCCTCGAGCGGGATTGG + Intronic
1002784480 6:391557-391579 GGGGCTGCCGCGGCCGGGGTGGG - Intergenic
1006506279 6:34490808-34490830 AGGGCTGCCGTGTCAGGCAGTGG - Intronic
1027592686 7:80135282-80135304 AGGGCGGCCGGGTCGGGGCCCGG + Intronic
1034968613 7:155405997-155406019 AGGGCTGCCGAGCAGGTGATGGG + Intergenic
1036282623 8:7414734-7414756 AGGGCTGCCACAGCGGGGCTTGG - Intergenic
1036338850 8:7896815-7896837 AGGGCTGCCACAGCGGGGCTTGG + Intergenic
1037599424 8:20381481-20381503 AGGGCTGCCAGGTTGGGGTTAGG + Intergenic
1037843069 8:22259362-22259384 AGGGCTCCCACCTCGTGGATGGG + Intergenic
1046719152 8:117599380-117599402 AGGGCTGGAGAGTCAGGGATGGG - Intergenic
1049223400 8:141438145-141438167 AGGCCTGCCGGCTTGGGGATGGG - Intergenic
1056837728 9:89970891-89970913 GGCGCTGCCGCTTCGGTGATGGG + Intergenic
1061866284 9:133493300-133493322 AGGGCTGCTGCGGAGGGGAGAGG - Intergenic
1062318146 9:135978218-135978240 AGGGCTGCTGAGAGGGGGATAGG - Intergenic
1062318216 9:135978422-135978444 AGGGCTGCTGTGGGGGGGATGGG - Intergenic
1062318230 9:135978453-135978475 AGGGCTGCTGAGGAGGGGATGGG - Intergenic