ID: 1171346796

View in Genome Browser
Species Human (GRCh38)
Location 20:24471208-24471230
Sequence GCCGCGTCGGGGATCGGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 42}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346781_1171346796 26 Left 1171346781 20:24471159-24471181 CCCCCAGAGCCGGCCAACTTCTC 0: 1
1: 0
2: 1
3: 30
4: 428
Right 1171346796 20:24471208-24471230 GCCGCGTCGGGGATCGGAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1171346785_1171346796 17 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346796 20:24471208-24471230 GCCGCGTCGGGGATCGGAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1171346788_1171346796 4 Left 1171346788 20:24471181-24471203 CCGTGCTAGGCTGCGACCTCAAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1171346796 20:24471208-24471230 GCCGCGTCGGGGATCGGAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1171346783_1171346796 24 Left 1171346783 20:24471161-24471183 CCCAGAGCCGGCCAACTTCTCCG 0: 1
1: 0
2: 0
3: 7
4: 55
Right 1171346796 20:24471208-24471230 GCCGCGTCGGGGATCGGAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1171346787_1171346796 13 Left 1171346787 20:24471172-24471194 CCAACTTCTCCGTGCTAGGCTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1171346796 20:24471208-24471230 GCCGCGTCGGGGATCGGAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1171346782_1171346796 25 Left 1171346782 20:24471160-24471182 CCCCAGAGCCGGCCAACTTCTCC 0: 1
1: 0
2: 3
3: 16
4: 147
Right 1171346796 20:24471208-24471230 GCCGCGTCGGGGATCGGAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42
1171346784_1171346796 23 Left 1171346784 20:24471162-24471184 CCAGAGCCGGCCAACTTCTCCGT 0: 1
1: 0
2: 1
3: 3
4: 76
Right 1171346796 20:24471208-24471230 GCCGCGTCGGGGATCGGAAGTGG 0: 1
1: 0
2: 0
3: 3
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346796 Original CRISPR GCCGCGTCGGGGATCGGAAG TGG Intronic
906087912 1:43151752-43151774 ACCGCGGCTGGGATGGGAAGTGG + Intronic
907501935 1:54887303-54887325 GCCGCGCCGGGGATCGGACCAGG + Intergenic
912518435 1:110229983-110230005 GCAGCGTCGGGGCTGGGCAGAGG + Intronic
920055321 1:203186739-203186761 GCCGCGTCGGGGAGTGGAGTGGG - Exonic
920071477 1:203305867-203305889 GCCGCCCCGGGGGTCGGAGGAGG - Intronic
924042539 1:239997851-239997873 GCCCCGTCGGGGACCGGGCGGGG + Intergenic
1065367839 10:24952635-24952657 GCTGCGTGGGGGATGGGACGTGG + Intergenic
1076889501 10:133276819-133276841 GCCGGGTCGGGGAGCAGAGGCGG + Exonic
1077194422 11:1272235-1272257 CCCGCTTCGGGGGTGGGAAGGGG - Intergenic
1080258730 11:30322997-30323019 GCCGCCTCCGGGGACGGAAGGGG - Intergenic
1084357549 11:68650176-68650198 CCCAGGTCGGGGAGCGGAAGAGG - Intergenic
1084412742 11:69013721-69013743 GCCGAGTCCGGGGTGGGAAGGGG - Intergenic
1085561262 11:77474198-77474220 GCCGCGCCGGGGAGGGGGAGTGG - Intronic
1094010427 12:25803285-25803307 GCGGCCTCGGGGAATGGAAGCGG + Intergenic
1101354692 12:103966025-103966047 GCGGCCTCGGGGAATGGAAGCGG + Exonic
1103899244 12:124295026-124295048 GCCGGGGCGGGGAGAGGAAGGGG + Intronic
1108623059 13:52202814-52202836 GCCGCGTCTGGGAGCTGCAGGGG - Intergenic
1118366680 14:65102369-65102391 GCGGCGGCGGGGAGGGGAAGGGG + Exonic
1122634468 14:103123589-103123611 GCCGCGGCGGGGACAGGAGGGGG + Exonic
1131401241 15:92127167-92127189 GCTGGGGCGGGGATTGGAAGGGG - Intronic
1132520056 16:382732-382754 GCCGCGTCGTGGGTGGGAGGGGG + Intronic
1132839447 16:1971949-1971971 GCTGCATCGGGAAGCGGAAGCGG - Intergenic
1137630086 16:49937046-49937068 GCCGCATCTGGAATGGGAAGGGG + Intergenic
1140440615 16:74984898-74984920 GCCGCGTGGGGGAGGGGAAGCGG + Intronic
1152567620 17:81107201-81107223 GCAGCGTCTGGGCTGGGAAGTGG + Intronic
1162808677 19:13151746-13151768 CCCGGGTCGGGGATGGGGAGGGG + Intronic
1164595799 19:29530093-29530115 GCCGCGGCCGGGCTCGGAGGTGG - Exonic
1167532537 19:50027039-50027061 GCTGCTGCGGGGATCAGAAGAGG - Intronic
1168353960 19:55690986-55691008 GCCCCGGCGGGGATGGGAAGGGG - Intronic
931253847 2:60554138-60554160 GCGGCGGCGGGGAGGGGAAGTGG - Intergenic
944743760 2:202635702-202635724 CCCGCGTCCGGCATCGGAGGAGG + Exonic
1171346796 20:24471208-24471230 GCCGCGTCGGGGATCGGAAGTGG + Intronic
1175521482 20:59605018-59605040 GCCGCGTCGGAGGACGGGAGCGG + Exonic
1176386016 21:6138836-6138858 CCCGCGGTGGGGATCGGGAGAGG - Intergenic
1179737457 21:43399416-43399438 CCCGCGGTGGGGATCGGGAGAGG + Intergenic
1179935976 21:44603465-44603487 GCCGAGTCTGGGATCCGCAGAGG - Intronic
1183553211 22:38505674-38505696 GCCCCGCGGGGGATCGGGAGGGG - Intronic
967883338 3:194316841-194316863 GCCGGGTGGGGGATGTGAAGTGG - Intergenic
1006472285 6:34235839-34235861 GCCGCCTCGGGGACCGGGCGCGG + Intergenic
1034940586 7:155227901-155227923 GCTGCGTGGGGGATCGGAGTGGG + Intergenic
1035153361 7:156893075-156893097 GCCGCGCCGGGGACCGGAGCCGG + Exonic
1044999696 8:97869012-97869034 GCCGCGGCGGGGGTGGGGAGCGG - Intronic
1049519541 8:143080902-143080924 GCCGCGTCCGGGAGCGCAGGAGG + Intronic
1054775571 9:69121384-69121406 GCAGCGGCGGGGAGGGGAAGGGG - Intronic
1059396201 9:114035525-114035547 GCTGCGATGGGGCTCGGAAGAGG - Intronic
1198310212 X:135422461-135422483 GCCGCGGCGGGGGGCGGAGGCGG + Intergenic