ID: 1171346798

View in Genome Browser
Species Human (GRCh38)
Location 20:24471220-24471242
Sequence ATCGGAAGTGGTCTTCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 80}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346787_1171346798 25 Left 1171346787 20:24471172-24471194 CCAACTTCTCCGTGCTAGGCTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1171346798 20:24471220-24471242 ATCGGAAGTGGTCTTCAAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 80
1171346785_1171346798 29 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346798 20:24471220-24471242 ATCGGAAGTGGTCTTCAAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 80
1171346788_1171346798 16 Left 1171346788 20:24471181-24471203 CCGTGCTAGGCTGCGACCTCAAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1171346798 20:24471220-24471242 ATCGGAAGTGGTCTTCAAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 80
1171346793_1171346798 0 Left 1171346793 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1171346798 20:24471220-24471242 ATCGGAAGTGGTCTTCAAAGAGG 0: 1
1: 0
2: 0
3: 6
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346798 Original CRISPR ATCGGAAGTGGTCTTCAAAG AGG Intronic
904083790 1:27889037-27889059 CTAGGCAGTGGTCTCCAAAGTGG + Intergenic
907664968 1:56426655-56426677 ATAGGAGGTGGTCTGCACAGGGG + Intergenic
916216474 1:162399450-162399472 ATCGGAAGTGGACTTCTGATGGG + Intronic
924444524 1:244116842-244116864 ATCACAAGTGTTCTTCTAAGAGG + Intergenic
1064706209 10:18074967-18074989 ATCAGAAGTGTCCTTAAAAGTGG + Intergenic
1066675606 10:37884031-37884053 ACCAGAAGTGATCTTCAAATTGG + Intergenic
1067281279 10:44875102-44875124 ATGGGAAGTGGTCATGAAAGAGG + Intergenic
1067809528 10:49416561-49416583 ATCCGAAGAACTCTTCAAAGGGG + Intergenic
1070774640 10:79102525-79102547 ACAGGATGTGGTTTTCAAAGAGG + Intronic
1081193311 11:40130679-40130701 AAAGGCAGTGGTTTTCAAAGAGG - Intronic
1085935342 11:81135057-81135079 ACTGGAAGTGGTATGCAAAGGGG + Intergenic
1086238726 11:84663115-84663137 ATCTGAGGTGATCTTCAAAATGG - Intronic
1087784624 11:102340966-102340988 ATCAGCAGTGGTATTTAAAGAGG - Intergenic
1090132718 11:124161399-124161421 ATGGGAAGGGATCTTCAGAGTGG - Intergenic
1093013995 12:14138130-14138152 GTTGGATGTGGTCTTCCAAGGGG - Intergenic
1093396677 12:18691623-18691645 AATGGAAGGGCTCTTCAAAGTGG + Intronic
1094368325 12:29707530-29707552 ATCAGAAGAGATCTTCAAAGAGG - Intronic
1094554168 12:31481842-31481864 AAGGGGAGTGGTTTTCAAAGGGG + Intronic
1104112833 12:125719658-125719680 ATCGGAAATGTTACTCAAAGGGG + Intergenic
1105403276 13:20113849-20113871 ATCACAAGTGTTCTTAAAAGTGG + Intergenic
1105454040 13:20524831-20524853 ATTGGAAGTGGTCTCCACACCGG + Intronic
1108528626 13:51307548-51307570 ATCAGAAGTGTCCTTAAAAGTGG + Intergenic
1108586826 13:51877159-51877181 ATGGGAAGAGGCCTTCAGAGGGG - Intergenic
1109219659 13:59628451-59628473 ATAGGAGGTGGTGATCAAAGTGG + Intergenic
1113085420 13:106565288-106565310 AGAGGAAATGGTCTTAAAAGTGG - Intronic
1113368734 13:109704069-109704091 ATTAGGAGGGGTCTTCAAAGTGG - Intergenic
1114317341 14:21521398-21521420 ATGGGTAGGGGTCTTGAAAGAGG + Exonic
1121852085 14:97230616-97230638 ATCGGGAGTGATCTTCTTAGAGG - Intergenic
1122291259 14:100681594-100681616 CTGGGAAGGGGTCTTCAAAGAGG + Intergenic
1126355855 15:47795301-47795323 AGCGGAACTGCTCTTAAAAGGGG + Intergenic
1127866054 15:63033978-63034000 ATCAGATATGGTCTTCAAAAAGG - Intergenic
1129613650 15:77081686-77081708 ATAGGAAGTGTTATTCCAAGAGG + Intronic
1133909262 16:10050143-10050165 ATCAGAAGTATTCTTCTAAGAGG + Intronic
1137684191 16:50374428-50374450 AAGTGATGTGGTCTTCAAAGGGG + Intergenic
1139841739 16:69887098-69887120 AACGTAAGTGATCATCAAAGAGG + Intronic
1144087532 17:11824113-11824135 ATAGAAAGGGGTCATCAAAGAGG - Intronic
1149594102 17:57853630-57853652 ATAGGAGGTAGTCTTTAAAGAGG - Intergenic
1152967780 18:132546-132568 TTTGGAAGTAGTGTTCAAAGGGG - Intergenic
1161497877 19:4597543-4597565 ATCTGAAGGGGTCTTCATGGAGG + Intergenic
1166611017 19:44196470-44196492 ATAGGCACTGTTCTTCAAAGGGG + Intergenic
1167238239 19:48327639-48327661 GGCGGGACTGGTCTTCAAAGGGG + Intronic
925827964 2:7869002-7869024 ATCAGAAGTGGTCTTATCAGAGG + Intergenic
929402166 2:41596678-41596700 ATAAGAAGTGATGTTCAAAGAGG - Intergenic
932856582 2:75240754-75240776 ATTGGCAGTTGTCTTCAGAGGGG + Intergenic
940980633 2:159998522-159998544 ATCGGAAGTGTTCTTCATTGAGG - Intronic
1169011291 20:2253005-2253027 ATCTGTAGGGGTCTTCAAACAGG + Intergenic
1171346798 20:24471220-24471242 ATCGGAAGTGGTCTTCAAAGAGG + Intronic
1172953207 20:38735710-38735732 CTCTGAAGAGGTGTTCAAAGCGG + Intergenic
1177162790 21:17566485-17566507 ATCTGTGGTGGTCTTCAAAATGG + Exonic
1183147124 22:36003544-36003566 ATTGGAGGTGGTGGTCAAAGTGG + Intronic
954668875 3:52277378-52277400 ATCAGAATTGGAATTCAAAGTGG + Intronic
955513594 3:59705618-59705640 ATCTCAAGTGTTCTTAAAAGTGG - Intergenic
957135285 3:76280028-76280050 ATAGGAAGTGTTCTTAAAACTGG - Intronic
958866913 3:99511400-99511422 CTCAAAAGTGGGCTTCAAAGTGG - Intergenic
959001646 3:100970890-100970912 TTGGGCAGTGGTCTTCACAGCGG + Intronic
962298830 3:134218785-134218807 TTCGGAAGTGGTCTTCTAACTGG - Intronic
965486856 3:169288630-169288652 ATCTGAAGTGGTATTCTATGGGG + Intronic
965617476 3:170610025-170610047 ATATGAAGTGGTCATCAATGTGG - Intronic
967071609 3:185967348-185967370 ATCGTAATTGGTCTTGAATGTGG + Intergenic
967791786 3:193557724-193557746 ATCCAAAGTGCTCTGCAAAGAGG + Intronic
969537571 4:7766179-7766201 GGCGGAAGTGTTCTGCAAAGGGG + Intronic
973852277 4:54972990-54973012 CTAGGAAGTGGTCATCATAGAGG + Intergenic
980970382 4:139561562-139561584 ATTGGAAATAGTTTTCAAAGGGG + Intronic
982412499 4:155094930-155094952 ATTGGGACTGGACTTCAAAGGGG - Intergenic
985489879 5:172983-173005 ACAGGATGAGGTCTTCAAAGAGG - Exonic
988622624 5:32839119-32839141 ATGGGAAGAGGTGTTCAATGGGG + Intergenic
995314577 5:110753751-110753773 ATTGGCAGTAGTCATCAAAGGGG + Intronic
996485011 5:124023245-124023267 ATGAGAAATGGTCTTTAAAGTGG + Intergenic
999223229 5:149998946-149998968 ATGGGCAGTGCACTTCAAAGAGG + Intronic
1003502144 6:6711705-6711727 ATTTGAAGAGGTCTTTAAAGAGG - Intergenic
1007962939 6:45977616-45977638 AGGGGAAGAGGTCTTGAAAGGGG - Intronic
1011239862 6:85259466-85259488 ATCTTAAATGGTCTTCAAAGTGG - Intergenic
1021474582 7:21046328-21046350 ATCGGAAGAGCTCTGTAAAGAGG - Intergenic
1026502335 7:70953300-70953322 ATCGCAAGTGTTCTTATAAGAGG + Intergenic
1027831148 7:83179290-83179312 ATGGCAAGGTGTCTTCAAAGAGG + Intergenic
1030148644 7:106380992-106381014 AGCGGATAGGGTCTTCAAAGAGG + Intergenic
1038162675 8:25055086-25055108 ATGTGAAATGGTCCTCAAAGTGG + Intergenic
1039476019 8:37839825-37839847 ATGGGAGATGGGCTTCAAAGTGG + Intronic
1041135430 8:54753070-54753092 CACAGAAGTGGTATTCAAAGTGG + Intergenic
1046408449 8:113806531-113806553 ATACCAAGTGATCTTCAAAGAGG + Intergenic
1052682936 9:31717402-31717424 ATCTGAAATAGTTTTCAAAGTGG - Intergenic
1060184956 9:121558621-121558643 GTGGGAAGGGGCCTTCAAAGAGG - Intergenic
1194762697 X:97813532-97813554 CTCGGAAGAGGTCTTCAGACTGG - Intergenic
1195883747 X:109619243-109619265 TTAGGAAGTGGTCCTAAAAGAGG + Intergenic
1196521381 X:116676867-116676889 ATCCAAAATGGTCTTCAAATGGG + Intergenic
1196542097 X:116922062-116922084 CTAGGAAGTGGCCTGCAAAGGGG + Intergenic
1197727259 X:129784676-129784698 ATGTGAAGTGGGCTTCAGAGAGG + Intronic