ID: 1171346799

View in Genome Browser
Species Human (GRCh38)
Location 20:24471221-24471243
Sequence TCGGAAGTGGTCTTCAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 88}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171346793_1171346799 1 Left 1171346793 20:24471197-24471219 CCTCAAGGGCTGCCGCGTCGGGG 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1171346799 20:24471221-24471243 TCGGAAGTGGTCTTCAAAGAGGG 0: 1
1: 0
2: 2
3: 7
4: 88
1171346788_1171346799 17 Left 1171346788 20:24471181-24471203 CCGTGCTAGGCTGCGACCTCAAG 0: 1
1: 0
2: 0
3: 5
4: 83
Right 1171346799 20:24471221-24471243 TCGGAAGTGGTCTTCAAAGAGGG 0: 1
1: 0
2: 2
3: 7
4: 88
1171346785_1171346799 30 Left 1171346785 20:24471168-24471190 CCGGCCAACTTCTCCGTGCTAGG 0: 1
1: 0
2: 0
3: 6
4: 72
Right 1171346799 20:24471221-24471243 TCGGAAGTGGTCTTCAAAGAGGG 0: 1
1: 0
2: 2
3: 7
4: 88
1171346787_1171346799 26 Left 1171346787 20:24471172-24471194 CCAACTTCTCCGTGCTAGGCTGC 0: 1
1: 0
2: 0
3: 6
4: 97
Right 1171346799 20:24471221-24471243 TCGGAAGTGGTCTTCAAAGAGGG 0: 1
1: 0
2: 2
3: 7
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171346799 Original CRISPR TCGGAAGTGGTCTTCAAAGA GGG Intronic
901083595 1:6597431-6597453 TGTGAAGGTGTCTTCAAAGAGGG - Intronic
901222624 1:7592230-7592252 GGGGAAGGGGCCTTCAAAGAGGG - Intronic
902145032 1:14391529-14391551 TCAGAAGTGGTCGTGAGAGAAGG - Intergenic
903142845 1:21349816-21349838 AGGGAAGCGGTCTTCAGAGATGG - Intergenic
904083791 1:27889038-27889060 TAGGCAGTGGTCTCCAAAGTGGG + Intergenic
911074866 1:93863257-93863279 TAGGAAGTGTCCTTCAAAGATGG - Intergenic
912627754 1:111220341-111220363 TCGGAAGTGGGAGTCAAAGCAGG - Intronic
914440079 1:147697822-147697844 CGGCAAGTGGTCTCCAAAGATGG - Intergenic
919345834 1:196377049-196377071 TAGGAAGTGGTGGTCAGAGAAGG + Intronic
924391238 1:243561367-243561389 TTGTAAGTGGTCTTCAAATTAGG + Intronic
924444525 1:244116843-244116865 TCACAAGTGTTCTTCTAAGAGGG + Intergenic
1063755922 10:9008366-9008388 CCGGAAGTGGTCCTGAAACAGGG + Intergenic
1064698851 10:17997505-17997527 TTGGTTGTGGTCTTGAAAGAAGG + Intronic
1067281280 10:44875103-44875125 TGGGAAGTGGTCATGAAAGAGGG + Intergenic
1071822479 10:89292495-89292517 AAGTAAGTGGTATTCAAAGATGG + Intronic
1073129072 10:101174413-101174435 CCGAAAGTGTTTTTCAAAGAGGG + Intergenic
1073329381 10:102660798-102660820 TCTGGAGTGGGCTTCAAAGCTGG - Intergenic
1075289295 10:121214458-121214480 TTGGAAGTGCTATGCAAAGAAGG + Intergenic
1076434077 10:130427615-130427637 TCAGATGTGGTCTCCAGAGAGGG + Intergenic
1078550579 11:12277451-12277473 TGGGAATTTGTCTGCAAAGATGG - Intronic
1083952466 11:65964613-65964635 TCTGAAGGGGTCTTTGAAGAAGG + Intronic
1085214610 11:74817840-74817862 TGGGAATTGGTTTTCAAATATGG + Intronic
1086609041 11:88731423-88731445 TCTGCACTGGTGTTCAAAGAAGG - Intronic
1088099171 11:106135435-106135457 TGGGAAGTGTTCTTTAAAGGTGG - Intergenic
1090110569 11:123903890-123903912 TGAGAAGATGTCTTCAAAGATGG + Intergenic
1090938055 11:131362749-131362771 TCAGAAGTGGTGTCCAGAGAAGG - Intergenic
1091771331 12:3153098-3153120 TCTGAAGAGGGCTTCAAGGAAGG - Intronic
1093013994 12:14138129-14138151 TTGGATGTGGTCTTCCAAGGGGG - Intergenic
1098754032 12:74335102-74335124 TTGCAAGTAGTCTTCAAAAATGG + Intergenic
1107201190 13:37719976-37719998 TCAGAAGTGTTCTTAAAAGATGG + Intronic
1107825575 13:44326071-44326093 TTGGAAGTGGTCTTGAAAGATGG - Intergenic
1110620247 13:77586524-77586546 GTGGAAGGGGTCTTCAAGGAAGG - Intronic
1118311029 14:64693135-64693157 TCGGAAAAGGACTTCAAAAAAGG - Intergenic
1119793817 14:77377596-77377618 GAGGAAGAGGACTTCAAAGAGGG + Exonic
1125245988 15:37640747-37640769 TCTGAAGTAGTATTAAAAGATGG + Intergenic
1129613651 15:77081687-77081709 TAGGAAGTGTTATTCCAAGAGGG + Intronic
1133909263 16:10050144-10050166 TCAGAAGTATTCTTCTAAGAGGG + Intronic
1149056220 17:52369482-52369504 ACTGAAGCGATCTTCAAAGATGG + Intergenic
1150934262 17:69618135-69618157 ATGGAAGTGGCTTTCAAAGATGG + Intergenic
1152458385 17:80428799-80428821 ACAGGAGAGGTCTTCAAAGAGGG + Intronic
1154303757 18:13216954-13216976 TCCGAAATGGTCTTCACAGGAGG + Intergenic
1162084668 19:8241243-8241265 TGGGGAGTGGTCTGGAAAGAAGG - Intronic
926583900 2:14663954-14663976 TCCGAAGTGGTCTTTGAAGCTGG + Intergenic
935434329 2:103012485-103012507 TCAGTTCTGGTCTTCAAAGAAGG + Intergenic
938997734 2:136698453-136698475 TGGGGAGTGGTCTTCGAAGTAGG + Intergenic
940515692 2:154681531-154681553 TAGAAAGTGGTCTTCCAAGGTGG + Intergenic
940662391 2:156562972-156562994 TAGTAAGTGGTCTTTAATGATGG + Intronic
941408630 2:165124693-165124715 TCTGAAATGGTCTTTAAAAAGGG - Intronic
946036236 2:216744600-216744622 TAGGAAGGGCTCTCCAAAGAAGG + Intergenic
946576738 2:221083713-221083735 TGGGAAGTGGTAGTCAAAGAAGG + Intergenic
947313034 2:228825012-228825034 TAGGAAGTTGTCTACAAATAAGG + Intergenic
948384817 2:237574869-237574891 TGGGAAGTGGTTTTCATAAAGGG + Exonic
1170509550 20:17062739-17062761 TCCCAAGTGTGCTTCAAAGAAGG - Intergenic
1171346799 20:24471221-24471243 TCGGAAGTGGTCTTCAAAGAGGG + Intronic
1172953208 20:38735711-38735733 TCTGAAGAGGTGTTCAAAGCGGG + Intergenic
1175359992 20:58402038-58402060 CCTGATGTGGTTTTCAAAGATGG + Intronic
1178630720 21:34258983-34259005 GAGGAAGAGCTCTTCAAAGAAGG + Intergenic
1179210103 21:39317188-39317210 CCAGAAGTGGTCTCCAAACAAGG + Intronic
1180200352 21:46220417-46220439 CAGGAAGAGGTCCTCAAAGAAGG + Intronic
956753856 3:72366683-72366705 TGGGAAGTGTTCTCGAAAGATGG - Intergenic
961552602 3:127677710-127677732 TCGGAAGTGGTCATCCAGCAGGG - Exonic
963622351 3:147626515-147626537 TTGGCAGTGGTTTTCAAAAAGGG - Intergenic
967718898 3:192794478-192794500 TCAGCAGTGGTCTTTAGAGAAGG - Intergenic
969842798 4:9895247-9895269 TCAGAAATGATCTTTAAAGATGG + Intronic
974059256 4:57015558-57015580 TCAGAAGTGGTCTACAAATACGG - Exonic
980484593 4:133439307-133439329 TAGGAAGTGTTCTTAAAAGGAGG - Intergenic
998796644 5:145827070-145827092 TCTGAAGAGTCCTTCAAAGAAGG + Intronic
999223230 5:149998947-149998969 TGGGCAGTGCACTTCAAAGAGGG + Intronic
1003496280 6:6666225-6666247 TAGAAGGTGGTCTTCAGAGATGG + Intergenic
1003622053 6:7709022-7709044 TCTGAAGGGGTCATCAAGGATGG + Intergenic
1003634806 6:7822350-7822372 TGGGACGTGGTCTGCAGAGACGG + Intronic
1005205210 6:23394756-23394778 TGGGAACTGGCCATCAAAGATGG - Intergenic
1008179093 6:48305448-48305470 TCAGAAGTGTCCTTTAAAGAGGG + Intergenic
1008622857 6:53288759-53288781 TAGGAAGAAGTCTTGAAAGAAGG - Intronic
1015895965 6:138017258-138017280 TTGGAAGAGGTCTTCAATGATGG + Intergenic
1016027050 6:139298494-139298516 AAGGAAGAGCTCTTCAAAGATGG - Intergenic
1017634162 6:156427223-156427245 TAGTAGGTGGTCTCCAAAGATGG + Intergenic
1017710711 6:157165033-157165055 TCTGAGGTGTTCTTCAAACAAGG - Intronic
1026502336 7:70953301-70953323 TCGCAAGTGTTCTTATAAGAGGG + Intergenic
1030148645 7:106380993-106381015 GCGGATAGGGTCTTCAAAGAGGG + Intergenic
1035321217 7:158030480-158030502 TTGGAAATGGTCTCCGAAGAGGG + Intronic
1035893511 8:3372167-3372189 TAGGAAGTGGTCTATAAATAAGG + Intronic
1036699118 8:11000010-11000032 TTTGAAGTTGTCTTCACAGATGG - Intronic
1044009085 8:86969406-86969428 CTGGTAGTGGTTTTCAAAGAAGG - Intronic
1045330381 8:101150892-101150914 ACGGAAGTGGTCATTACAGAGGG + Intergenic
1045773852 8:105778073-105778095 TCCAAAGCGGTTTTCAAAGAAGG + Intronic
1049117232 8:140699486-140699508 TCTGAAGTGGTTTTCAATAAGGG + Intronic
1050714535 9:8507317-8507339 TATGAACTGGTCTACAAAGATGG - Exonic
1051126503 9:13811355-13811377 TAGGCAGAGGGCTTCAAAGAGGG - Intergenic
1057068552 9:92076545-92076567 ATGGAAGTGGTCATCAAAGGAGG - Intronic
1059621880 9:116014692-116014714 TCAGAAGTGGTTTTAAAATAGGG - Intergenic
1060184955 9:121558620-121558642 TGGGAAGGGGCCTTCAAAGAGGG - Intergenic
1186527691 X:10264568-10264590 TAGGAAGTGGTCTCCAAAGATGG + Intergenic
1192770473 X:74184372-74184394 TAGTAAGTGGAATTCAAAGATGG + Intergenic
1195213377 X:102671889-102671911 TAGGAAGTGGGCTCAAAAGAAGG - Intergenic
1197954990 X:131936799-131936821 TAGGAAGTCATCTTCAATGAAGG - Intergenic
1198659694 X:138954827-138954849 TTGCTAGTGGTCCTCAAAGACGG - Intronic
1200807806 Y:7450097-7450119 GCGGAAGTGAACTTTAAAGATGG - Intergenic