ID: 1171348297

View in Genome Browser
Species Human (GRCh38)
Location 20:24483518-24483540
Sequence AGTACAGGAAGAGCAAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 324}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171348297 Original CRISPR AGTACAGGAAGAGCAAACAC TGG (reversed) Intronic
901115516 1:6840763-6840785 AGTGCAGGAGGAGCCAGCACAGG + Intronic
904556305 1:31367009-31367031 AACACAGGAAGAGCAAACAAAGG + Intronic
905032612 1:34897701-34897723 AGTGGAGCAAGAGCAAATACAGG + Intronic
905230907 1:36514465-36514487 AGTACAGGAAGGGCAAGGAGGGG + Intergenic
905330249 1:37189946-37189968 AATACAGAAACAGGAAACACAGG - Intergenic
905754122 1:40493347-40493369 AGTTGAGGAAGAGAAAACCCAGG - Intronic
905878798 1:41450174-41450196 AGTACACAAAGAGCAAACCTTGG - Intergenic
905939161 1:41849096-41849118 GGGACAGGAAGGGGAAACACGGG + Intronic
906097425 1:43233840-43233862 AGCACTGGATGAGCTAACACGGG + Intronic
906359870 1:45145849-45145871 AGAACAGGAAGAACAAGCAAAGG + Intronic
907066648 1:51490904-51490926 ACTACAGCAATAGCAAAAACAGG - Intronic
907352638 1:53845476-53845498 AGTAGAGAAAGAGCAAACTTTGG + Intergenic
909151352 1:72010011-72010033 ATGACAGGAAGAGGAACCACTGG + Intronic
909692023 1:78420270-78420292 ATTACAAAAAGAGAAAACACAGG - Intronic
910397778 1:86808968-86808990 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
911130052 1:94378101-94378123 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
911251228 1:95578813-95578835 AGTGCAGGAAGAGAACACAAAGG + Intergenic
913423766 1:118703915-118703937 AATATAGGAACAACAAACACTGG - Intergenic
914903006 1:151721817-151721839 AGTGCAGGAAGAACTAACTCAGG + Intronic
915712943 1:157918586-157918608 AGAACAGGAAGATCTCACACCGG - Intergenic
915975036 1:160379863-160379885 AGTACAGGAGGAGGAACAACGGG - Intergenic
916225440 1:162485544-162485566 AATACAGGAATGGCAAATACAGG + Intergenic
917742941 1:177979066-177979088 AGTAGAGGAAAATCAACCACAGG + Intronic
920304931 1:205012632-205012654 AGTACAGGAAGCAAAAACAAGGG + Intronic
920624475 1:207583164-207583186 ACTGCAGTAAGAGAAAACACAGG + Intronic
920699883 1:208209735-208209757 ATTGCAGGAAGAGGAAAGACTGG + Intronic
920842174 1:209564085-209564107 AGTACAGGAAATAAAAACACAGG - Intergenic
922473621 1:225891080-225891102 AGAACAGGAAGTGCCCACACAGG - Intronic
922950213 1:229552914-229552936 AGCAGAGGAAGAGGAAGCACAGG + Intronic
924024132 1:239815075-239815097 AGAAAAGGAAAAGCAAACAGCGG - Intronic
1063079948 10:2757729-2757751 AGTATTGGAAAAGCAAACCCTGG - Intergenic
1063259528 10:4370264-4370286 AGGGCAGAAAGAGGAAACACTGG - Intergenic
1063859342 10:10290924-10290946 AGTACAGGAAAAGCACAAGCTGG + Intergenic
1067314205 10:45146155-45146177 AGTAGATGATGAGCAAAGACTGG + Intergenic
1068768791 10:60797325-60797347 AGTACAGGAGGAGAAATCAAAGG + Intergenic
1072044055 10:91637238-91637260 AGTCCAGTAAGAGCAGACAATGG + Intergenic
1073008457 10:100342079-100342101 TGGAGAGGAAAAGCAAACACAGG - Intergenic
1074363231 10:112839122-112839144 AGAGCAGGAAGAGCAGACACTGG + Intergenic
1075067095 10:119296424-119296446 AGTAAAGGGAGAGGAACCACTGG + Intronic
1077008768 11:370856-370878 GGTACAGGAAGAGAACACAGGGG - Intronic
1077732942 11:4753571-4753593 ATTTCAGGAAGAGCAAATAAAGG - Intronic
1080714001 11:34780444-34780466 AGTACAGAAAGAGAAAAGATAGG - Intergenic
1081145762 11:39561491-39561513 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1081421157 11:42875683-42875705 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1084804408 11:71569060-71569082 GGAACAGGAAGAGCCTACACAGG + Intergenic
1086091216 11:83007139-83007161 AGAGCCAGAAGAGCAAACACAGG + Intronic
1087074770 11:94118978-94119000 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1087374305 11:97322692-97322714 AGTAAAGGAAGAGGAAATAAAGG - Intergenic
1087671677 11:101114168-101114190 AGGACAGGAAGATCTAACCCTGG - Intronic
1088492302 11:110400189-110400211 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1088687003 11:112292491-112292513 AGTACAGAAAGGGCAAACAGAGG - Intergenic
1089029791 11:115313754-115313776 AGTACAGGAGGAGCAACCTCAGG - Intronic
1089730885 11:120518030-120518052 AGAACAGGGAGAGCAGAAACCGG - Intronic
1089969450 11:122680756-122680778 AATAAAGGAAGAGCACAGACAGG - Intronic
1091120986 11:133057412-133057434 AGGACAGGAAGGGCAGAGACTGG - Intronic
1091542584 12:1475580-1475602 AGGAAAGGAAAAGCAAAGACAGG + Intronic
1091661406 12:2386595-2386617 GGTATAGGAAGAGCTCACACAGG - Intronic
1092764987 12:11844720-11844742 AGTAAAGAAAGAGCCAACTCTGG - Intronic
1094756969 12:33482334-33482356 AATACAGGAAGAGCAGAAATAGG + Intergenic
1095817773 12:46443415-46443437 GGTACGTGAAGAGCAAACATGGG - Intergenic
1095955182 12:47801994-47802016 ACAACAGGAAAAGGAAACACAGG - Intronic
1096262997 12:50104527-50104549 AGTACAGGAGGAGGGAACAGTGG - Intronic
1097438164 12:59576400-59576422 ACTAGAGGAAGGGGAAACACAGG + Intergenic
1098824574 12:75278810-75278832 TGTAAAGGATGATCAAACACTGG - Intronic
1099414989 12:82373743-82373765 AGTACAGGAAAAGCAGAAGCTGG + Intronic
1099522192 12:83678282-83678304 AGTACAGAATGAGCAAAGAATGG - Intergenic
1099712385 12:86243949-86243971 AGTCCAGGAGGAGAAAAGACTGG + Intronic
1100051005 12:90447578-90447600 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1101311839 12:103587736-103587758 AGTACAGGAAGAGCAACAAGTGG - Intronic
1102852255 12:116259549-116259571 GGGAGAGGAAGAGCACACACAGG + Intronic
1102878574 12:116466840-116466862 AGTGAAGGAAGAGCAACCAGAGG - Intergenic
1105255625 13:18742593-18742615 AGTACAGGAAGTCCATGCACAGG + Intergenic
1106671744 13:31913513-31913535 AGTACAGTAAGAGAATACATAGG + Intergenic
1107099575 13:36575088-36575110 ATTACAGGAACAGCAATTACAGG + Intergenic
1108423229 13:50271721-50271743 AGTGGAGGAAGAACAAATACAGG - Intronic
1109241426 13:59894378-59894400 AGTACAGGTTGAGGAAACAGTGG + Intronic
1110358872 13:74602088-74602110 ATTACAAAAAGAGCTAACACTGG - Intergenic
1110752198 13:79127819-79127841 GTTCCAGGAAGAGCAAACAGTGG + Intergenic
1112427267 13:99314104-99314126 GGTACAAACAGAGCAAACACAGG - Exonic
1112492225 13:99877312-99877334 AATACAGGAAGAGGAAAGAGAGG - Intronic
1113498703 13:110755662-110755684 TGTCTAGGAAGAGCAAAGACAGG - Intergenic
1113773014 13:112923834-112923856 AGTAAAGAAAGATAAAACACAGG - Intronic
1115266223 14:31503381-31503403 AGGAAAGGAAGAGATAACACTGG - Intronic
1115437554 14:33392828-33392850 AGCAGAGGAAGAAAAAACACTGG - Intronic
1116861666 14:50000607-50000629 AGAACAGAAAGAGCAGACAGAGG + Intronic
1117586174 14:57208262-57208284 AGTACAAGAACCGAAAACACTGG + Exonic
1118794691 14:69130822-69130844 GGTACAGGAAGTGCAAGCTCTGG + Intronic
1118901106 14:69986687-69986709 AGAAGAGGAAGAGGAAGCACCGG - Intronic
1120614352 14:86684396-86684418 AGTACATGGAGAGAAAATACAGG - Intergenic
1120624604 14:86809447-86809469 GGTACAGCAAGGGAAAACACAGG - Intergenic
1122849145 14:104517293-104517315 AGCACAGGAACAGCAGATACAGG - Intronic
1122953014 14:105056296-105056318 AGAACAGTGAGTGCAAACACAGG - Intronic
1125067900 15:35513109-35513131 AGTACAGCAATACCACACACAGG + Intronic
1127724997 15:61741259-61741281 AACACAGAAAGAGCAGACACAGG - Intergenic
1129449450 15:75642265-75642287 ATTTCAGGAAGAGGAAACAGTGG + Intronic
1129554327 15:76489463-76489485 ACTACAGGAATAGAAAACAAGGG - Intronic
1130073532 15:80669216-80669238 AGTGCAGCAAAACCAAACACTGG - Intergenic
1130797449 15:87224911-87224933 AGAACAGAAAGAGGACACACTGG + Intergenic
1130838623 15:87676030-87676052 AGCACAGGGAGGGAAAACACAGG + Intergenic
1131805941 15:96122776-96122798 AGTACAGGCATCGCCAACACTGG + Intergenic
1132223380 15:100122181-100122203 AATACAGGAAGAGCAGAAGCAGG - Intronic
1133733066 16:8592378-8592400 AGTAAGGGAAGAGCAACCAGAGG + Intergenic
1134837026 16:17369799-17369821 TGTGCAGGAAGAGAAAACAGTGG - Intronic
1135715125 16:24757663-24757685 AATAAAGGAAGAGCAGACATTGG + Intronic
1138107509 16:54296743-54296765 AGTACAGAACCACCAAACACAGG - Intergenic
1138481186 16:57304310-57304332 AGTACAGGAAGAGCCACGTCGGG - Intergenic
1139628867 16:68214879-68214901 ACTACCGGAAGTGCAAACATGGG - Intronic
1140091462 16:71842478-71842500 AATACAGGGAGAGGAAACTCAGG - Intergenic
1140254397 16:73322506-73322528 AATGCAGGAATAGCAAACATAGG + Intergenic
1140460212 16:75133514-75133536 AACACAGGAACAGAAAACACAGG - Intergenic
1203141941 16_KI270728v1_random:1772408-1772430 AGTACAGTTAGTGTAAACACGGG - Intergenic
1144967361 17:19086146-19086168 ACAACAGGAAGAGCTAACATAGG + Intergenic
1144980558 17:19165920-19165942 ACAACAGGAAGAGCTAACATAGG - Intergenic
1144987664 17:19212313-19212335 ACAACAGGAAGAGCTAACATAGG + Intergenic
1146241596 17:31233866-31233888 AGTACAGGTATAACAAATACAGG - Intronic
1148407242 17:47426483-47426505 ACTTCAAAAAGAGCAAACACTGG + Intronic
1149089155 17:52757693-52757715 AGCAATAGAAGAGCAAACACAGG + Intergenic
1149408089 17:56375340-56375362 AGGACAGGTAGAGCAAACTAAGG + Intronic
1150341431 17:64371147-64371169 AGCACAGGAATAGAAAACATGGG + Intronic
1150449702 17:65256609-65256631 GATACAGGAAGAGCAAAGCCTGG - Intergenic
1151588243 17:75024877-75024899 AGTGTAAGAAAAGCAAACACTGG + Intergenic
1154435399 18:14338082-14338104 AGTACAGGAAGTCCATGCACAGG - Intergenic
1155241530 18:23867917-23867939 GGTAAAGGAAGAGCAACCATAGG + Exonic
1155493313 18:26420468-26420490 TTTCCAGCAAGAGCAAACACAGG + Intergenic
1156192104 18:34731610-34731632 AGTACAGTTACTGCAAACACTGG - Intronic
1156270228 18:35523870-35523892 AGAACAGGAAGAGCAAGGATGGG - Intergenic
1156317699 18:35986208-35986230 ATTACAGGAAGACCCAACAGAGG - Intronic
1156930827 18:42641018-42641040 AGGACAGGAAGGGCAAGGACTGG - Intergenic
1158709203 18:59822259-59822281 AGAACAGGAAAAGCAGAAACTGG + Intergenic
1159475849 18:68920211-68920233 AGGAAAAGAAAAGCAAACACTGG - Intronic
1162492891 19:11004772-11004794 AGTAAAGGAGGAACAAAAACAGG - Intronic
1162776824 19:12984883-12984905 AGTACAGGAAGAGCAGGGAGGGG - Intergenic
1162944981 19:14037611-14037633 ATTCCAGGAAGAGGAAACACAGG - Intronic
1163258962 19:16175182-16175204 AGGCCAGGTAGAGAAAACACAGG - Intergenic
1163900839 19:20098818-20098840 ATGACAGGAGGAACAAACACAGG - Intronic
1164699244 19:30271220-30271242 AGTACAGGGTGTGCAAACACAGG - Intronic
1164993222 19:32699465-32699487 AGTACAGGAAAAGCAGAAGCTGG + Intronic
1165846853 19:38823600-38823622 AGTACAGGAAAAGCAGAAGCTGG - Intronic
1165981445 19:39727719-39727741 AGTTCAGGAAGAGCTTACAGTGG - Intergenic
1166561136 19:43733102-43733124 AGTACAGGAAGAGCTCAGCCGGG - Intronic
1167869384 19:52355174-52355196 AGTACAGGAAGAAAGACCACAGG - Intronic
1168724706 19:58574711-58574733 AGGAAAGGAAGAATAAACACTGG - Intergenic
925691706 2:6531009-6531031 AATTCAGGAAGAGACAACACTGG - Intergenic
926149341 2:10415958-10415980 AGCACAGGAGGAGCCACCACGGG + Intronic
927252277 2:21007319-21007341 AGTATAAGAAAAACAAACACAGG - Exonic
928891596 2:36210271-36210293 AGAACAGGAAGAAGAAACAAGGG - Intergenic
930038244 2:47101286-47101308 AGTACAGGAAAAGCAGAAGCTGG - Intronic
932310898 2:70739838-70739860 AAGAAAGGAACAGCAAACACTGG + Intronic
932877213 2:75465464-75465486 AGAACAGGCCAAGCAAACACAGG + Intergenic
933341905 2:81035970-81035992 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
934485361 2:94703455-94703477 TGGACAGGAACAACAAACACTGG - Intergenic
937524428 2:122749656-122749678 AATGCAGGAAGGGCCAACACAGG + Intergenic
937866866 2:126759090-126759112 AGTAGATGAGGACCAAACACTGG + Intergenic
938278552 2:130049305-130049327 AGTACAGGAAGTCCAAGCACAGG + Intergenic
938329528 2:130440164-130440186 AGTACAGGAAGTCCCAGCACAGG + Intergenic
938360420 2:130681339-130681361 AGTACAGGAAGTCCCAGCACAGG - Intergenic
938436823 2:131288047-131288069 AGTACAGGAAGTCCCAGCACAGG - Intronic
939421414 2:141975497-141975519 ATTGAAGGAAGAGAAAACACTGG + Intronic
940075424 2:149736100-149736122 AGTATATGAAGAGTAAACACTGG + Intergenic
940742554 2:157526243-157526265 ATTCCAGGAAGAACAAACAGTGG + Intergenic
942239013 2:173941704-173941726 AGTAGAGGAAGAGCTAGCAAAGG - Intronic
943139565 2:183963801-183963823 GGTACAGGAAGTGGAAACAGTGG + Intergenic
943531960 2:189093453-189093475 AGTGCAGAGGGAGCAAACACAGG + Intronic
943715891 2:191151538-191151560 AGGTCAGGAAGGGCAAGCACTGG - Intronic
943731341 2:191306419-191306441 AGAAGAGGAAGAGCAGACCCAGG + Intronic
943795635 2:191989548-191989570 ACTCTAGGAAGAGAAAACACTGG + Intronic
947148631 2:227091473-227091495 AGTACAGAAAGAGAAAAAAGAGG + Intronic
1169647876 20:7833835-7833857 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1169922503 20:10750188-10750210 AGTACAGGAAGAGCAAATTGAGG - Intergenic
1171348297 20:24483518-24483540 AGTACAGGAAGAGCAAACACTGG - Intronic
1172247447 20:33455732-33455754 AGAAGAAGAAGAGGAAACACAGG + Intergenic
1172544664 20:35750545-35750567 AGTAAAGAAATAGCAGACACAGG + Intergenic
1173269239 20:41516891-41516913 GGAACAAGAAGAGCCAACACTGG + Intronic
1174420251 20:50394712-50394734 GGGACACGGAGAGCAAACACCGG - Intergenic
1175650264 20:60715567-60715589 AGTGCAGGCAGAGCAAGCCCTGG - Intergenic
1176412711 21:6457649-6457671 GGCACAGGAAGAGCAGACTCCGG + Intergenic
1176841641 21:13847623-13847645 AGTACAGGAAGTCCATGCACAGG + Intergenic
1177945774 21:27468381-27468403 AGTGGAGGAAGAGAAAAGACCGG - Intergenic
1178233065 21:30809561-30809583 AGTGCAGGAAAAGAAAAAACAGG + Intergenic
1179080325 21:38164935-38164957 ATGACAGGAAGAGCAGACACTGG + Intronic
1179688205 21:43065971-43065993 GGCACAGGAAGAGCAGACTCCGG + Intronic
1182898662 22:33879554-33879576 AGGACAGGAAGAGCAAAGACAGG - Intronic
1183103234 22:35596825-35596847 AGTCCAGGAACAGCAAACCCAGG + Intergenic
1183165266 22:36142845-36142867 AGTACAGGCCCAGCAAGCACGGG - Intronic
1184408177 22:44311986-44312008 AGGGCAGGAAGAGGAAAGACAGG + Intronic
949171452 3:1003260-1003282 TGTACAGCAAGAGCAAACTTGGG + Intergenic
949596778 3:5556240-5556262 TAAACAGGAAGAGCAGACACAGG + Intergenic
950635201 3:14309170-14309192 GGAACAGCAAGAGCAAAGACAGG + Intergenic
952002823 3:28806793-28806815 ACTACAGGAAGAGGACACAGTGG - Intergenic
952669971 3:35954506-35954528 AGTTCTGGAAAAGCAGACACTGG - Intergenic
953137379 3:40193012-40193034 AGTCCAGGAAAAACAAAAACTGG - Intronic
953800248 3:46017491-46017513 AGTATAGTAAGAGAAAACAGAGG + Exonic
953800625 3:46019962-46019984 AGTTGAGGAAAAGAAAACACAGG + Exonic
953829488 3:46283165-46283187 AGTTCAAGAATAGCAAAAACGGG + Intergenic
953847007 3:46435721-46435743 AGGGCAGGAAGAGCAAGCATAGG - Exonic
954232523 3:49228281-49228303 AGTACAGGAAAAGCAGAAGCTGG + Intronic
955577890 3:60386467-60386489 AGTACAGGAAGAGGAACAAGTGG - Intronic
955760153 3:62271467-62271489 AGTACTGGAAGGGCATACTCGGG - Exonic
959892872 3:111576226-111576248 AGAACAGGAAAAGAAAAAACTGG + Intronic
960321693 3:116244498-116244520 AGAGCAGGAAGAACAGACACAGG - Intronic
960385996 3:117022760-117022782 AGGAAATGAAAAGCAAACACTGG - Intronic
960585450 3:119316947-119316969 AGGTCAGGGAGAGCAAAGACAGG - Intronic
961673932 3:128553646-128553668 AGTCCAGGCAGAGCGAACAGAGG + Intergenic
961830930 3:129622722-129622744 AGTTAATGAAGAGGAAACACAGG + Intergenic
962675748 3:137756889-137756911 AGGACAGGAACATCACACACCGG + Intergenic
962717765 3:138141930-138141952 AGTACAGGGAGGGGAAACCCAGG + Intergenic
963760795 3:149285385-149285407 AGTACAGGAAAAGCAAAAGCTGG - Intergenic
964386273 3:156151295-156151317 AGGAGAGGAAGAGGAATCACTGG - Intronic
964805244 3:160602460-160602482 AATACAGCATGAGCAAAAACAGG - Intergenic
965062477 3:163802370-163802392 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
967768747 3:193311406-193311428 ATTACAGCAAGAGGAAACAAAGG - Intronic
967821431 3:193842707-193842729 CACACAGGAAGAGCACACACTGG + Intergenic
968909477 4:3470214-3470236 AGAACAGGAGGCGCAGACACAGG - Intronic
969513805 4:7635030-7635052 GGGACAGGAAGAGGAAATACTGG + Intronic
971520388 4:27542148-27542170 AATAAAGGAACAGCAAAGACAGG - Intergenic
972373653 4:38449982-38450004 AGCAGAGGAGGAGCAAGCACAGG - Intergenic
972915030 4:43866481-43866503 ATTACAGGATGATCAAACAGGGG - Intergenic
973045603 4:45532162-45532184 AGTACAGGAACAGCAGAAGCTGG - Intergenic
974187043 4:58458881-58458903 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
974509463 4:62819118-62819140 AGTACAAGAACCGAAAACACTGG - Intergenic
974972026 4:68842512-68842534 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
975047735 4:69825634-69825656 AGTACAGGAAAAGCAGAAACTGG - Intronic
976514897 4:85953976-85953998 AGGAAAGGAAGAGGAAACAGTGG + Intronic
976844584 4:89473536-89473558 AGTACAGGAAGAGAAAAGTTGGG - Intergenic
977913020 4:102559452-102559474 AGGACAAGCAGAGGAAACACAGG + Intronic
980291170 4:130848500-130848522 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
980673955 4:136049886-136049908 AGTACTGGAGGAGCATAGACAGG + Intergenic
980772316 4:137392082-137392104 AATACAGCATGAGCAAATACAGG - Intergenic
981050411 4:140304236-140304258 AGTAGATCAAGAGCAAAAACAGG + Intronic
983712619 4:170738121-170738143 AGGACACGAATAACAAACACAGG - Intergenic
983918452 4:173317115-173317137 CGTAGATGAAAAGCAAACACAGG - Intronic
987929614 5:24387824-24387846 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
987952834 5:24698033-24698055 AGTTAAGCAATAGCAAACACTGG - Intergenic
988357555 5:30198417-30198439 AGTACAAGAAAAGCAGAAACTGG - Intergenic
989016886 5:36946435-36946457 AATACAGGAATGGCAAATACAGG - Intronic
990116460 5:52398015-52398037 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
990486813 5:56267431-56267453 AGGAGAGGGAGAGCACACACAGG - Intergenic
990927620 5:61046262-61046284 ACTACAAGAAAAGAAAACACAGG - Intronic
991950744 5:71944757-71944779 AGTACAGCAAAAGCAAAAGCAGG - Intergenic
992454931 5:76908206-76908228 AGTACAGGAAAAGCAGAAACTGG - Intronic
992491200 5:77246363-77246385 AGGTCAGGAAGAGAAAACAAGGG + Intronic
993818231 5:92580210-92580232 AGTACAGGAACAGTAATTACAGG + Intergenic
994571363 5:101518071-101518093 AGGACAGGAAGAGCTAAAACAGG - Intergenic
995928097 5:117400329-117400351 AATACAGGAAGAACAAAGTCAGG - Intergenic
996305635 5:122044030-122044052 AGGAGAGGAACAGCAGACACTGG - Intronic
999572761 5:152939290-152939312 AGTCCAGGAAAAGGAAACACAGG + Intergenic
1000084952 5:157880718-157880740 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1000329924 5:160198294-160198316 GGGACAGGGAGAGCAAAGACTGG - Intronic
1002391071 5:178912240-178912262 GGTACATGATGACCAAACACAGG - Intronic
1005602189 6:27438362-27438384 ACTACAGGAAAAGGAAATACTGG + Intergenic
1006258897 6:32852677-32852699 AGTTCTGGTAGAGCAACCACAGG - Intronic
1007563659 6:42831414-42831436 AGTATAGTAAGAGCAAGCTCAGG - Intronic
1008587291 6:52961326-52961348 AGTACAGGAAAAGCAGAAGCCGG + Intergenic
1009551111 6:65092738-65092760 AGCGCAGGAAGATCTAACACAGG + Intronic
1009872499 6:69468942-69468964 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1010005689 6:70992562-70992584 AGGAGAGAAAGAGCAAGCACAGG - Intergenic
1010258911 6:73792934-73792956 TGTGCAGGAAGTGCAAACAATGG + Intronic
1011261846 6:85477895-85477917 AGCACTGGAATTGCAAACACTGG - Intronic
1011281675 6:85684437-85684459 AGAAAAGGAAGAGCAAACAAAGG + Intergenic
1011842125 6:91514442-91514464 AGTAGAGGAAGCACAAGCACAGG - Intergenic
1012130380 6:95483571-95483593 AGCAGAGGAATAGCTAACACAGG - Intergenic
1012631615 6:101476854-101476876 AGTTCAGGAAGAGAAAGCAGTGG + Intronic
1013184934 6:107749300-107749322 AAATCTGGAAGAGCAAACACAGG + Intronic
1013189664 6:107791483-107791505 AGTACTGGAAGAGCAGAGAAGGG + Intronic
1016183740 6:141176882-141176904 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1016637091 6:146305079-146305101 AGTAAAGGAAAAGCAAACTGAGG + Intronic
1017395717 6:153997211-153997233 AGCACAGGAAGAGGAAACCGAGG + Intergenic
1017524471 6:155230403-155230425 AGGACAGGAACAGCTAACACTGG - Intronic
1017537810 6:155367071-155367093 AGTACAGGAAAAGTAAAAACAGG - Intergenic
1018236659 6:161732408-161732430 AAGACAGGAACAGCAGACACTGG - Intronic
1019078986 6:169414943-169414965 AGTACTGGAAGATCAATCATTGG + Intergenic
1020507689 7:9014261-9014283 AGTTCTGGGAGAGAAAACACTGG - Intergenic
1021356870 7:19660392-19660414 AGTACAGGAAAAGCGAAAGCTGG + Intergenic
1021996757 7:26186106-26186128 ACTTCAAAAAGAGCAAACACTGG + Exonic
1022544474 7:31173325-31173347 AGTAGAGGAAGGGCAAACAAAGG - Intergenic
1022879190 7:34567891-34567913 AGAACAGGCAGAGGAAACATAGG + Intergenic
1023078225 7:36503955-36503977 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1023151330 7:37203884-37203906 AGTACAGGAAAAGCAGAAGCTGG + Intronic
1023470342 7:40510946-40510968 GCTCCAGGAAGAGAAAACACAGG + Intronic
1024365800 7:48518987-48519009 AGGACAGGAACAACACACACTGG - Intronic
1024735001 7:52295610-52295632 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1026043543 7:66888632-66888654 TCTGCAGGAACAGCAAACACAGG - Intergenic
1026425523 7:70288518-70288540 AGCACAGGCAGACCAAACCCAGG - Intronic
1026855008 7:73747647-73747669 AGTCCAGGAGGAGGCAACACAGG + Intergenic
1027428882 7:78089387-78089409 AATAAAGGAAGAACAAGCACTGG + Intronic
1027573444 7:79901610-79901632 AGACAAGGAAGAGCAATCACTGG - Intergenic
1027787880 7:82603029-82603051 AGAACAGGAAGAACTAATACTGG - Intergenic
1027790835 7:82637805-82637827 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1028280703 7:88924371-88924393 AGAACAGGAAAATCAGACACAGG - Intronic
1028921862 7:96318436-96318458 AGTACAGGCAGATCTAACAAGGG + Intronic
1029894012 7:103962400-103962422 AGAGCAGGAAGAGCAAAGAGAGG - Intronic
1030420230 7:109299918-109299940 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1030547411 7:110914095-110914117 GGTCCAGGAAGAGCAAAAGCAGG - Intronic
1030581830 7:111365986-111366008 AGTAAATGAAGAGGAAATACTGG + Intronic
1031663822 7:124460328-124460350 ATTTCAGGGAGAGGAAACACTGG + Intergenic
1033066777 7:138163481-138163503 AGTTCTGGAACAGCAGACACAGG + Intergenic
1033073476 7:138226161-138226183 AGTCCAGGAGGACCAAACAGAGG - Intergenic
1033094641 7:138419800-138419822 AATTGAGGAAGAGCAAACATAGG + Intergenic
1034512543 7:151548067-151548089 TGTACAGGAAATGCAGACACAGG - Intergenic
1034547124 7:151796444-151796466 AGTACGTGAAGGGCAATCACAGG + Intronic
1035918786 8:3654451-3654473 GGTACAGGAAGAGGGTACACAGG + Intronic
1036435331 8:8728007-8728029 AGTAGGGGAACAACAAACACTGG + Intergenic
1037289820 8:17338468-17338490 AGAAAAGGAAGAGAAAAGACGGG - Intronic
1037689890 8:21172751-21172773 AGTGCTGGAAGAGAAAACCCAGG - Intergenic
1037932833 8:22892879-22892901 AGTACAGAAAGAGAGAACCCAGG + Intronic
1038075446 8:24067630-24067652 CGAACAGGATTAGCAAACACTGG - Intergenic
1038638504 8:29305770-29305792 AGTACAGGAAAAGCAGAAGCTGG - Intergenic
1038931457 8:32198117-32198139 AGTACAGGATGATCAAGCAATGG - Intronic
1039167647 8:34702805-34702827 AGTACAGGAAAAGAAAACATAGG - Intergenic
1039999986 8:42567525-42567547 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1040589225 8:48774120-48774142 AGTGCAGGCAGAGCAATCAAGGG - Intergenic
1040971743 8:53142776-53142798 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1040971746 8:53142803-53142825 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1041336446 8:56789737-56789759 AGTAAAAGAAAAGCAAACAAGGG + Intergenic
1043186486 8:77158099-77158121 AGTATAGGATGAGCAAATGCAGG + Intergenic
1044129836 8:88508244-88508266 AGAAAAAGAAGAGCAAACAAAGG + Intergenic
1044297402 8:90545000-90545022 AGTGGAGAAAGAGCAAACAGAGG - Intergenic
1046062661 8:109157751-109157773 ATTACAGAAACAGCATACACAGG - Intergenic
1047920192 8:129627798-129627820 AGCACAGGAGGAGCAATGACGGG + Intergenic
1048347898 8:133591758-133591780 AGTGCAGGAAGAGAAAGCCCTGG + Intergenic
1048691385 8:136968578-136968600 AGGATAGTAAGAGGAAACACTGG + Intergenic
1052265499 9:26567143-26567165 AGGAATGGAAGAGCAAACAAGGG - Intergenic
1052575727 9:30288489-30288511 AGTACAGGAAGGTAAAACCCAGG + Intergenic
1052881488 9:33603357-33603379 AGTACAGGAAGTCCATGCACAGG - Intergenic
1053487095 9:38467579-38467601 AGTACAGGCAGGGGAAACCCAGG - Intergenic
1054786480 9:69215133-69215155 AGGACAGGAACAGTAAACACTGG + Intronic
1055471694 9:76618190-76618212 AGTTCACAAAGAGCAAAGACTGG - Intronic
1056233724 9:84571472-84571494 AGAACGGGAAGAACAAACATTGG - Intergenic
1056393082 9:86156554-86156576 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1057330479 9:94110001-94110023 AGTTCAGCATGACCAAACACTGG + Intergenic
1058561623 9:106235036-106235058 AGGATAGGAATAGAAAACACTGG + Intergenic
1062232521 9:135489891-135489913 TGGACAGGAACAGCAACCACAGG - Intergenic
1062308157 9:135921249-135921271 AGTGCAGGACGGGCAAACCCAGG - Intergenic
1185550503 X:980088-980110 AGTACAGTTAGTGTAAACACGGG + Intergenic
1187094803 X:16136514-16136536 AGTACTGGAAGACCAACGACAGG + Intronic
1187313573 X:18170166-18170188 TGTAATGGAAGAGAAAACACTGG + Intronic
1187424370 X:19163888-19163910 AGTCCGGGTAGAGCAAAAACAGG - Intergenic
1187693199 X:21892735-21892757 AGTACAGGAATAGGAAACAAAGG + Intergenic
1188223950 X:27574244-27574266 AGTACAGGAAGAACAAATATGGG + Intergenic
1189077378 X:37930737-37930759 GGAACATGAAGAACAAACACAGG + Intronic
1189575513 X:42348898-42348920 AGTACAGGGAGAGTAAAAAGGGG + Intergenic
1189678001 X:43483095-43483117 ATCACAGGCAGAGAAAACACAGG + Intergenic
1190066979 X:47248136-47248158 ACTGCTGGAAGGGCAAACACAGG - Exonic
1195093318 X:101484262-101484284 AGTACATGAATGGCAGACACCGG + Intronic
1197735617 X:129848740-129848762 AGTACAGGCTGAGCAAACTATGG - Intergenic
1200214986 X:154364243-154364265 AGTCCAGGTAGAGCACCCACGGG - Exonic
1200801273 Y:7389066-7389088 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1200966482 Y:9043957-9043979 AGTACAGGAAGAGCAGAAGTTGG - Intergenic
1201429398 Y:13889663-13889685 AGTACAAGAAGAGCAGAAGCTGG - Intergenic
1201568847 Y:15393025-15393047 AGTACAGGAAAAGCAGAAGCTGG + Intergenic
1202146965 Y:21808216-21808238 AGTACAGGAAAAGCAGAAGCTGG + Intergenic