ID: 1171349047

View in Genome Browser
Species Human (GRCh38)
Location 20:24488854-24488876
Sequence GAGCATCCCCGGGCGCTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171349041_1171349047 -8 Left 1171349041 20:24488839-24488861 CCAGGCCTGGTGCCAGAGCATCC 0: 1
1: 0
2: 3
3: 18
4: 278
Right 1171349047 20:24488854-24488876 GAGCATCCCCGGGCGCTCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 85
1171349038_1171349047 17 Left 1171349038 20:24488814-24488836 CCAGTATCTGCTGATGTCTTTAA 0: 1
1: 0
2: 1
3: 34
4: 226
Right 1171349047 20:24488854-24488876 GAGCATCCCCGGGCGCTCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 85
1171349037_1171349047 22 Left 1171349037 20:24488809-24488831 CCTCTCCAGTATCTGCTGATGTC 0: 1
1: 0
2: 2
3: 38
4: 712
Right 1171349047 20:24488854-24488876 GAGCATCCCCGGGCGCTCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171349047 Original CRISPR GAGCATCCCCGGGCGCTCGG AGG Intronic
901225243 1:7609498-7609520 GAGCATCCCTGGGGGCCTGGAGG - Intronic
901762169 1:11478656-11478678 GGGCATCCCCGGGCGCCCTCCGG - Intergenic
902528908 1:17077744-17077766 GAGCATCCCATGTGGCTCGGAGG + Intronic
904032977 1:27544687-27544709 GATCATCCCCTGGCACTGGGGGG + Intronic
918605444 1:186419481-186419503 GAGCATCACCTGGGGCTGGGAGG + Exonic
924172451 1:241356786-241356808 GAGCGTCCGCGGGCGCAGGGCGG - Intronic
1063350324 10:5348172-5348194 GAGGAGCCCCGGGGGCTCAGTGG + Intergenic
1071579727 10:86757392-86757414 AAGCAGCTCCGGGAGCTCGGGGG - Intronic
1076770164 10:132658632-132658654 GAGCACCCCCGGGGGGCCGGCGG - Intronic
1095441043 12:42238611-42238633 GAGCATCCCCTGCCAGTCGGTGG - Intronic
1096477712 12:51918541-51918563 GAGCAGTCCCGGGCACTGGGTGG + Intronic
1096592219 12:52667895-52667917 GAGCATCCCAGGGCATTCTGAGG + Intergenic
1096747570 12:53738695-53738717 GAGCCTCCCCCGCCGCTCAGGGG + Intergenic
1097166645 12:57089635-57089657 GGGCATCCCCTGGTGCTTGGAGG - Intronic
1100539925 12:95548465-95548487 CAGCATCTCCGGGCACTCTGAGG + Intronic
1102318026 12:111905523-111905545 GAGTTTCCCCGGGCCCTGGGTGG - Intergenic
1103527821 12:121579437-121579459 CAGCTTCCCCGGTAGCTCGGGGG - Intronic
1105243722 13:18629024-18629046 GAATAACCCCGGGCGCTCTGAGG - Intergenic
1105502862 13:20988293-20988315 GAGCATGCCCTGGCGCTGGGCGG - Exonic
1108559519 13:51628453-51628475 GAGCATCCCTGGACTCTCAGGGG - Intronic
1113977070 13:114235343-114235365 GAGGCGCCCCGTGCGCTCGGGGG - Intronic
1119180892 14:72604717-72604739 GAGCCTCCCTGGGGGCTGGGAGG - Intergenic
1122138872 14:99650333-99650355 GAGCATCCCCCGAAGCTCTGGGG + Intronic
1122264884 14:100541909-100541931 CAGCAGCCCCGGGCCCTGGGTGG - Intronic
1124109239 15:26772211-26772233 CACCCGCCCCGGGCGCTCGGGGG - Intronic
1130370856 15:83284494-83284516 GAGAATCCCCGCGCCCGCGGAGG + Intronic
1132481034 16:166182-166204 GCGGATCCCCGGGCTCTGGGCGG + Intronic
1132733962 16:1376406-1376428 GAGCATCCCCAAGCCCTCAGAGG - Intronic
1132978921 16:2724953-2724975 GGGCATCCCTGTGCTCTCGGGGG + Intergenic
1134290812 16:12901914-12901936 GAGCGGCGCGGGGCGCTCGGTGG - Exonic
1136913689 16:34162744-34162766 GGGAATCCCCGGGCGCCCGTGGG + Intergenic
1137262789 16:46844615-46844637 GGGCATGTGCGGGCGCTCGGTGG + Intergenic
1142154607 16:88527412-88527434 CTTCATCCCCGGGTGCTCGGAGG - Intronic
1142156169 16:88533764-88533786 GCGCGTCCTCGGGCGCACGGCGG - Exonic
1142291174 16:89194212-89194234 GAGCATCCCCTGGGCTTCGGTGG + Intronic
1142708481 17:1710520-1710542 GACCATGCCCTGGAGCTCGGGGG + Intergenic
1142713106 17:1733963-1733985 GAGCTTCCCGGGCCACTCGGGGG + Exonic
1147684000 17:42276258-42276280 GAGCAGCCGCGGGCGCCCGAGGG - Exonic
1148406883 17:47423727-47423749 GGGCGTTCCCGGGCGCACGGCGG + Intronic
1152663174 17:81552354-81552376 GAGAAGCCCCGGCCGCGCGGCGG + Exonic
1154445220 18:14430861-14430883 GAATAACCCCGGGCGCTCTGAGG + Intergenic
1160025354 18:75211555-75211577 GCGCAGCAGCGGGCGCTCGGCGG - Intronic
1160242398 18:77132909-77132931 GCGCCGCCCCGGGAGCTCGGAGG + Intronic
1160712044 19:556635-556657 GAGCATCTCCGGGTGGCCGGTGG + Intergenic
1160835186 19:1121653-1121675 CAGCATCCCAGGGCTCTCGTCGG - Intronic
1162007181 19:7788327-7788349 GAGCAGCGCCGCGCGCTCCGTGG - Intergenic
1165423252 19:35732591-35732613 GAGCAGCCACGGGGGCCCGGGGG + Exonic
927684369 2:25160592-25160614 GAGTGACCCCGGGCGCTCAGGGG - Intergenic
937251170 2:120524706-120524728 GAGCATCCCCGTGTGCTCCCCGG + Intergenic
942046031 2:172100150-172100172 GAGGCTTCCCGGGCGCTCTGAGG - Exonic
1171349047 20:24488854-24488876 GAGCATCCCCGGGCGCTCGGAGG + Intronic
1171446352 20:25207248-25207270 GGGCAGCCCCGGGGGCCCGGTGG + Exonic
1171978193 20:31608613-31608635 GAGCATCCCCAGGTGTACGGAGG + Intergenic
1176450772 21:6859002-6859024 GAATAACCCCGGGCGCTCTGAGG - Intergenic
1176680823 21:9818405-9818427 GAGCATCGCGGCGCGCGCGGCGG - Intergenic
1176828941 21:13724020-13724042 GAATAACCCCGGGCGCTCTGAGG - Intergenic
1181803490 22:25361717-25361739 GTGGATCCCCGGGCCCTGGGGGG - Exonic
1182583102 22:31327054-31327076 GTGCATGTCCGGGCTCTCGGGGG - Exonic
1182586686 22:31347374-31347396 TAGCATCCCCGGGCGGGCCGGGG - Intergenic
953368735 3:42369601-42369623 GAGGAACCCCAGGCTCTCGGAGG + Intergenic
955016933 3:55079530-55079552 GAGCATTCCTGGGTGTTCGGTGG - Intergenic
959476666 3:106820990-106821012 GGGCATCCCTGTGCTCTCGGGGG + Intergenic
989537523 5:42581846-42581868 GGGCATCCCCGTGCTCTCGGGGG + Intronic
992499604 5:77329018-77329040 GAGGATCACCGTGTGCTCGGAGG - Exonic
997468210 5:134102179-134102201 GAGCAGCCCCCGCCGCTCTGGGG + Intergenic
1004304383 6:14487244-14487266 GAGCCTCCCCGTGCCCTTGGGGG + Intergenic
1007214697 6:40228065-40228087 GGGCATCCCTGTGCTCTCGGGGG + Intergenic
1016936318 6:149451323-149451345 GAGCCGCCCGGGGCTCTCGGTGG + Exonic
1019470050 7:1214681-1214703 GCGCATCCCCGGGAGCCAGGGGG + Intergenic
1021575911 7:22105675-22105697 GAGCATCCCAGGGAGCTGGATGG - Intergenic
1021992609 7:26152474-26152496 GGGCGTTCCCGGGCGCGCGGCGG + Exonic
1026890225 7:73977431-73977453 GAACAGCCCCGGGCCCTCTGGGG + Intergenic
1033742092 7:144283633-144283655 GAGCATCCCAAGGAGCTTGGAGG + Intergenic
1033751810 7:144365981-144366003 GAGCATCCCAAGGAGCTTGGAGG - Intronic
1034446717 7:151117443-151117465 GAGCATCACCTGGAGCTCAGGGG - Exonic
1035022037 7:155805816-155805838 TAGGATCCACGGGCGCCCGGCGG + Intronic
1035044286 7:155953705-155953727 CATCCTCCCCGGGCTCTCGGGGG - Intergenic
1035205771 7:157292994-157293016 GGGCCTCACCGGGCGCTGGGAGG - Intergenic
1035643077 8:1198502-1198524 GAGCATCCCCCAGAGCTCGGGGG + Intergenic
1036060006 8:5306496-5306518 GCGCATCCCCGGGAACTCAGAGG + Intergenic
1045252605 8:100494286-100494308 GAGCCTCACCGGGAACTCGGGGG + Intergenic
1045300832 8:100908560-100908582 GGGCATCCCTGTGCTCTCGGGGG - Intergenic
1059657396 9:116368941-116368963 GAGCATGCCGGGGCGCACAGAGG - Intronic
1060018837 9:120110955-120110977 GAGCATCCCCAGGCACTCTCAGG - Intergenic
1062031645 9:134364646-134364668 GAGCAGCCCTGGGTGCTCTGTGG + Intronic
1062325832 9:136012113-136012135 GAGCCTCCCCGGCCGCTCCTGGG + Intronic
1203518409 Un_GL000213v1:25515-25537 GAATAACCCCGGGCGCTCTGAGG + Intergenic
1192265439 X:69534208-69534230 GAGCATCCCCGTGCTCTTGAGGG - Intergenic
1198788259 X:140314286-140314308 GAGCTTCCCCAGGCCCTGGGTGG - Intergenic