ID: 1171349401

View in Genome Browser
Species Human (GRCh38)
Location 20:24491162-24491184
Sequence GCCAACTGGTTAGCATCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 54}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171349401_1171349409 27 Left 1171349401 20:24491162-24491184 CCTTAAGATGCTAACCAGTTGGC 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1171349409 20:24491212-24491234 CCATTTTGGGAATTCTTTGAAGG 0: 1
1: 0
2: 1
3: 15
4: 249
1171349401_1171349406 14 Left 1171349401 20:24491162-24491184 CCTTAAGATGCTAACCAGTTGGC 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1171349406 20:24491199-24491221 GGTCAGCCGCGATCCATTTTGGG 0: 1
1: 0
2: 0
3: 0
4: 15
1171349401_1171349403 -7 Left 1171349401 20:24491162-24491184 CCTTAAGATGCTAACCAGTTGGC 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1171349403 20:24491178-24491200 AGTTGGCTCCAATGAGTGTGAGG 0: 1
1: 0
2: 1
3: 10
4: 151
1171349401_1171349405 13 Left 1171349401 20:24491162-24491184 CCTTAAGATGCTAACCAGTTGGC 0: 1
1: 0
2: 1
3: 5
4: 54
Right 1171349405 20:24491198-24491220 AGGTCAGCCGCGATCCATTTTGG 0: 1
1: 0
2: 0
3: 0
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171349401 Original CRISPR GCCAACTGGTTAGCATCTTA AGG (reversed) Intronic
904696436 1:32334401-32334423 GCCATCTGGTTCTCCTCTTAAGG - Exonic
919449034 1:197747959-197747981 GCTAACTGGTTAGCCTCTTATGG - Intronic
919741114 1:200982258-200982280 GCCAGCTGGCTAACATCTTGTGG + Intronic
921013016 1:211161603-211161625 GCCAACCGGAAAGCATCTGAAGG + Intergenic
922352409 1:224744946-224744968 GCCAACTGTTTAGTTTTTTAGGG + Intergenic
923158618 1:231299227-231299249 GCTATCTGGTTAACACCTTATGG - Intergenic
923427230 1:233883113-233883135 ACCAAATGGTTTGGATCTTATGG - Intergenic
924262417 1:242245843-242245865 CACCACTGGTTTGCATCTTAAGG + Intronic
1065368618 10:24959068-24959090 ACAAACTGATTAGCATCTGAGGG + Intergenic
1069672875 10:70224524-70224546 CCAAACTGGTTAGGGTCTTATGG + Intronic
1070958862 10:80484926-80484948 GATAACTGGTTAGCAACTTGAGG - Intronic
1073846279 10:107558851-107558873 GTCATCTGGACAGCATCTTATGG - Intergenic
1078184624 11:9041112-9041134 AATAACTGGCTAGCATCTTAAGG - Intronic
1079095095 11:17504850-17504872 AACAACTGGGTAGCATCTTTGGG - Intronic
1084731347 11:71075630-71075652 GCCTTCTGGTTTGCATCTTGTGG - Intronic
1092135454 12:6143823-6143845 GCCAACTGGTGGGCATGTCATGG + Intergenic
1102335600 12:112076601-112076623 CCCAACTGTTTAGCAGATTAAGG + Intronic
1109140344 13:58707017-58707039 GGCATCAGGTTAGCATTTTAAGG - Intergenic
1111450237 13:88405713-88405735 GCCAACTGTTTACCAACTCATGG + Intergenic
1128823855 15:70690901-70690923 GCCAACTAGTTAGAATTTTGTGG + Intronic
1144106156 17:11987531-11987553 GCTAACTAGTTATCATCTGAAGG + Intronic
1149456837 17:56794925-56794947 GCCAGCTGGTTAGCTGGTTATGG - Intronic
1150708967 17:67513799-67513821 TCCCACTGCTTAGCATCCTATGG + Intronic
1166160825 19:40951553-40951575 GCCAAAAGGTTAGCATCTCAGGG - Intergenic
1166169735 19:41019288-41019310 GCCAAAAGGTTAGCATCTCAGGG - Intergenic
925487545 2:4352575-4352597 GCCAAGTGTTTAGCATGTAAGGG - Intergenic
928773784 2:34733989-34734011 TGCAACTGGTTAGCATCTAGTGG - Intergenic
939501116 2:142986100-142986122 TCCTATTGGATAGCATCTTAAGG - Intronic
942402642 2:175619872-175619894 TACAACTGATTAGCATCTTCTGG - Intergenic
1171349401 20:24491162-24491184 GCCAACTGGTTAGCATCTTAAGG - Intronic
1171935693 20:31272884-31272906 GCGAACTCCTTAGCATCTTAGGG - Intergenic
1185246794 22:49776976-49776998 ACCTCCTGGTTAGCGTCTTAGGG - Intronic
960756190 3:121015953-121015975 GAAGACTGGTTAGCATGTTATGG - Intronic
966174489 3:177120919-177120941 GCAAATTGGTTAACATTTTAGGG - Intronic
968383889 4:119666-119688 GCCAACTGCTTAGTAGCTTTGGG + Intergenic
968770333 4:2501587-2501609 GGAATCTGGTCAGCATCTTAAGG + Intronic
981786591 4:148486358-148486380 ACCAACTGGCTATCATCTTAAGG + Intergenic
986760240 5:10873710-10873732 GCCATCTGGTTGTCTTCTTAAGG + Intergenic
989735723 5:44702481-44702503 GTCAAAAGGTTAGCATCTCACGG - Intergenic
990467071 5:56080476-56080498 GGCAACTAGTTAGCATCTTCAGG + Intergenic
991451527 5:66756071-66756093 GGAAACATGTTAGCATCTTAAGG - Intronic
995623682 5:114054969-114054991 GCCATCTGATTACCTTCTTACGG - Intergenic
995830864 5:116354190-116354212 GCCAGCTACTTGGCATCTTATGG - Intronic
1003143765 6:3492904-3492926 GCAAACAGCTTGGCATCTTAGGG - Intergenic
1008434482 6:51459075-51459097 GCAGACTGGTTAGAATTTTAAGG - Intergenic
1021595461 7:22311864-22311886 GCCAATTAGTCAGCATCTCAGGG + Intronic
1028239726 7:88404964-88404986 TCCACCTTGTTAGCATCTTCAGG + Intergenic
1038506531 8:28089690-28089712 GCATACTGGTGGGCATCTTATGG + Intronic
1041113319 8:54508020-54508042 GCCAACTGATAATCATCTTGGGG - Intergenic
1041194035 8:55382615-55382637 GATAACTGATAAGCATCTTAAGG + Intronic
1042443828 8:68860661-68860683 CACAACTGGTTTGGATCTTAGGG - Intergenic
1050023689 9:1311025-1311047 CCCAACTGGTAAGCGACTTAGGG + Intergenic
1050654057 9:7805919-7805941 GACAACTGGGTAGCCTCTGAGGG - Intronic
1051328300 9:15997311-15997333 GCCAACTGCTGAGCATGGTAGGG - Intronic
1051330817 9:16023328-16023350 GCAAAATGATTAACATCTTAAGG + Intronic
1057279460 9:93699456-93699478 GCCAACTGGATGGCATGCTAAGG + Intergenic
1057740304 9:97705590-97705612 GCCACCTGGTTAGCCACGTAGGG - Intergenic
1060447933 9:123709046-123709068 GCCAGCTGGTCAGCATATCAAGG + Intronic
1186397454 X:9224238-9224260 GCCACCTAGGTAGCATCTTTTGG - Intergenic
1187307771 X:18112478-18112500 GCCAAGGGGTTAGCCTCCTAGGG - Intergenic
1195953996 X:110309442-110309464 GAGAACTGGTCAGCATCTTCTGG + Intronic