ID: 1171352930

View in Genome Browser
Species Human (GRCh38)
Location 20:24518618-24518640
Sequence ACGCTCTGGGCAGAAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 289
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171352926_1171352930 8 Left 1171352926 20:24518587-24518609 CCTTGTTTCAAAACAAAGCTCAC 0: 1
1: 0
2: 1
3: 37
4: 520
Right 1171352930 20:24518618-24518640 ACGCTCTGGGCAGAAGGTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171352930 Original CRISPR ACGCTCTGGGCAGAAGGTGC TGG Intronic
901305224 1:8227896-8227918 ACGATCATGGCAGAAGGTGAAGG - Intergenic
902690671 1:18108458-18108480 GCTGTGTGGGCAGAAGGTGCGGG + Intronic
903016697 1:20366364-20366386 AGGGTCTTGGCAGAAGGTGGAGG - Intergenic
903260837 1:22131150-22131172 ACACTGTGGCCAGAAGCTGCTGG + Intronic
903560078 1:24220615-24220637 TGGCTCTGGGGAGAAGGTGGGGG - Intergenic
905110567 1:35591523-35591545 ACGCTCTGGGGTGAAGGTCCAGG - Intronic
905448217 1:38041155-38041177 ACCTTCTGGGCAGTAGGTGGGGG + Intergenic
905459733 1:38114727-38114749 AGGCACTGGGGAGGAGGTGCTGG + Intergenic
907731530 1:57071156-57071178 CAGCTCTGGGCAGAAGAGGCTGG + Intronic
907980999 1:59480740-59480762 ATGATGTGGGAAGAAGGTGCTGG + Intronic
912712861 1:111961930-111961952 AAACTCAGGGCAGAAGCTGCAGG - Intronic
915238468 1:154502482-154502504 CAGCTCTGGGCAGGAGGTGGCGG - Intronic
915636762 1:157193000-157193022 ATTCCCTGGGCAGAAGGTCCAGG + Intergenic
916174740 1:162028738-162028760 AGGCTCTGAGCAAAAGATGCAGG - Intergenic
918421739 1:184371125-184371147 GCTCTCTAGGCAGAGGGTGCTGG - Intergenic
919760896 1:201097457-201097479 ACACTCTGGGCAGAGGGGCCGGG - Intronic
922210214 1:223480663-223480685 GCGCTCTGTGCAGCAGGAGCTGG - Intergenic
922321892 1:224495780-224495802 ACTCTCTGGGCAAGAGGAGCGGG + Intronic
922666269 1:227472028-227472050 ACGATCATGGCAGAAGGTGAAGG - Intergenic
923650221 1:235866797-235866819 ACGCTGCCGGCAGAAGGTTCCGG - Intronic
1062950862 10:1502209-1502231 CCGCTGGGGGCAGCAGGTGCAGG - Intronic
1063122187 10:3112989-3113011 ACTATCTGGGCAGAAGGAGGAGG - Intronic
1064902755 10:20312522-20312544 ACACTCATGGCAGAAGGTGAAGG + Intergenic
1065206168 10:23359835-23359857 ACGGCCTAGGCAGAAGGAGCTGG - Intergenic
1066411997 10:35180821-35180843 AGGGGCTGGGCAGAAGCTGCTGG + Intronic
1066449705 10:35517603-35517625 CTGCTCTAGGCAGAAGGTGGAGG + Intronic
1067499205 10:46786702-46786724 ACGCACTGCGCAGACGGCGCCGG + Intergenic
1067595436 10:47553650-47553672 ACGCACTGCGCAGACGGCGCCGG - Intergenic
1067851652 10:49758687-49758709 TCCCACTGGGCAGATGGTGCTGG + Intronic
1067951211 10:50739794-50739816 ACGCACTGCGCAGACGGCGCCGG + Intronic
1069707250 10:70466768-70466790 ACACTCTGGGGAGAAGGGGCAGG + Intergenic
1070886538 10:79904857-79904879 ACGCACTGCGCAGACGGCGCCGG + Intergenic
1071302241 10:84264721-84264743 TCGCACTGGGCAGAATGTGAGGG + Intergenic
1072368844 10:94743759-94743781 ACAATCTTGGCAGAAGGTGAAGG - Intronic
1075023328 10:118966922-118966944 TCACCCTGGCCAGAAGGTGCAGG - Intergenic
1075612612 10:123865717-123865739 CAGCTCTGGGCAGTAGCTGCAGG - Intronic
1076412371 10:130261478-130261500 ACCCTCTGAGCAGGAGGTGGAGG - Intergenic
1076835521 10:133019264-133019286 ACGCCCAGCGCGGAAGGTGCCGG - Intergenic
1077170647 11:1164512-1164534 ACCCTCAGGGCAGAAGCAGCCGG - Exonic
1080866986 11:36204205-36204227 AGGCTCTGGGCAGAACATCCTGG + Intronic
1081004154 11:37713036-37713058 ATACTCTGGGCAGAAGGCACTGG - Intergenic
1081638073 11:44734131-44734153 CCACTCAGGGCAGAAGGTGAAGG - Intronic
1081861184 11:46334095-46334117 ACCCTCTGGGCAGAGGTGGCAGG - Intronic
1083084934 11:60133282-60133304 ACAATCTGGGCAGAAGATGAAGG - Intergenic
1083633017 11:64105395-64105417 ACGCTCTGGGCAGACAGACCTGG + Intronic
1083962306 11:66021183-66021205 AAGCTGTGGGCAGAAGGAGTGGG + Exonic
1083994855 11:66266853-66266875 AGGCTGTGGGCAGAGGGGGCAGG - Exonic
1084273638 11:68041310-68041332 CCGCTGTGGGCAGAAAGAGCTGG - Exonic
1084737309 11:71113834-71113856 GCGATCTGGGCAGAGGTTGCAGG - Intronic
1085987007 11:81799940-81799962 ACAGTCTTGGCAGAAGGTGAAGG - Intergenic
1086393655 11:86391883-86391905 ACAATCATGGCAGAAGGTGCAGG + Intronic
1087538972 11:99490867-99490889 ATCCTCTGGGCAGGAGCTGCAGG + Intronic
1090912593 11:131134487-131134509 AGGCTCTTGGCAGCAGCTGCAGG + Intergenic
1092289908 12:7153841-7153863 ACACTCAGGGGAGAAGGTGCTGG - Intronic
1094708793 12:32940769-32940791 ACAATCATGGCAGAAGGTGCAGG - Intergenic
1096004531 12:48158247-48158269 AAGCTCTGGGGAGTAGGTGTGGG - Intronic
1096147950 12:49292434-49292456 GGACTCTGGGCAGATGGTGCAGG - Intergenic
1099973874 12:89525987-89526009 CCGCTCTGGGCAGACGGTTCCGG - Exonic
1102367164 12:112347747-112347769 ATGCTCAGGGCAGAAGGAGATGG + Intronic
1102810418 12:115819526-115819548 ACGGTCATGGCAGAAGGTGAAGG + Intergenic
1103725625 12:122996157-122996179 ACTCTTTGGCCAGAATGTGCTGG + Intronic
1104113484 12:125726071-125726093 ACGATCATGGCAGAAGGTGAGGG + Intergenic
1104560709 12:129841485-129841507 ACGCTCTTGGCAGAAGTTCATGG - Intronic
1106760064 13:32859269-32859291 GTGCTCTGGGAAGAAGCTGCAGG - Intergenic
1107050606 13:36044174-36044196 CCACTCTTGGCAGAAGGTGAAGG - Intronic
1108077565 13:46697247-46697269 ACGTTGTGAGCAGAGGGTGCAGG - Intronic
1108477464 13:50835151-50835173 AAGTTCTGTGCAGAATGTGCAGG - Intronic
1111956084 13:94759862-94759884 AGGCTTTGGGCAGAAGCTGTGGG + Intergenic
1112301056 13:98230910-98230932 ACACTCATGGCAGAAGGTGAAGG + Intronic
1117051888 14:51868633-51868655 AGGTTTTGAGCAGAAGGTGCAGG + Intronic
1117623619 14:57613066-57613088 AAGATCTGGGCAGCAGGAGCTGG + Intronic
1119384607 14:74249851-74249873 TCGCTCTGGGCTGGAGGTGGAGG + Intronic
1119539311 14:75428236-75428258 ACCCACCGTGCAGAAGGTGCGGG - Intronic
1121727957 14:96166667-96166689 AAGGTCTGGGGAGAAGGTGGTGG - Intergenic
1122045504 14:99020427-99020449 ACGATCATGGCAGAAGGTGAAGG + Intergenic
1122128595 14:99592462-99592484 TCCCTCTGGGCAGGAGGGGCTGG + Intronic
1122129853 14:99598643-99598665 ACTCTCTGGGCAGCAGGCACAGG + Intronic
1122555584 14:102577658-102577680 ACACTTTGGGCAGAAGAGGCGGG + Intergenic
1122702298 14:103598097-103598119 ACCCCCTGGGAAGAAAGTGCTGG - Intronic
1122924107 14:104891944-104891966 GCCATCTGGGCAGAGGGTGCTGG + Intronic
1123099897 14:105790567-105790589 AGGCTCTGGGCGCAAGCTGCTGG - Intergenic
1124136152 15:27037984-27038006 AGGCTCTGGCCAGCAGATGCAGG + Intronic
1124608982 15:31194596-31194618 ACAATCAGGGCAGAAGGTGAAGG + Intergenic
1125715456 15:41817443-41817465 CCGCACTGCGCAGAAGGTGAGGG + Exonic
1127969655 15:63948378-63948400 ACACTCATGGCAGAAGGTGAAGG + Intronic
1128511312 15:68315616-68315638 AAGCTTTGGGGAGAAGGAGCAGG + Intronic
1128826264 15:70720164-70720186 ACAATCAGGGCAGAAGGTGAAGG - Intronic
1128905796 15:71466634-71466656 ACAATCTGGGCAAAAGGTGATGG - Intronic
1128943552 15:71807236-71807258 AGGGTCTGGGCAGAAGGAGCAGG + Intronic
1131632720 15:94196142-94196164 GCCCTCTGGGCACAGGGTGCAGG + Intergenic
1132576665 16:667412-667434 ACTCTGTGGGTAGACGGTGCAGG - Exonic
1134138536 16:11696831-11696853 ACCCTCTGGGCAGAGGCTGTGGG + Intronic
1136247878 16:28985654-28985676 GTGCTTAGGGCAGAAGGTGCTGG - Intronic
1138116088 16:54361830-54361852 ACGCTCAGGGGAGAGGGTGAGGG + Intergenic
1139135944 16:64205005-64205027 ACAATCTTGGCAGAAGGTGAAGG + Intergenic
1139309656 16:66017831-66017853 CAGCTCTGGGCAGCAGGTGCCGG + Intergenic
1139331535 16:66196081-66196103 AGGCTCTGGGCTGAAAGTGGGGG + Intergenic
1139970178 16:70769424-70769446 CCGCTGTGGGAAGAAGGTGGTGG + Intronic
1140384421 16:74521917-74521939 ACGCTCTGGGCAGAGTTTCCAGG + Intronic
1140566288 16:76046720-76046742 ACAATCATGGCAGAAGGTGCAGG + Intergenic
1141699972 16:85637906-85637928 ACGTCCTGGGCAGAGGGGGCAGG + Intronic
1142291902 16:89197089-89197111 AGGCTCTGGGCAGACGGCTCAGG - Intronic
1142986310 17:3697120-3697142 ACACTCAGGGCGGATGGTGCGGG + Intergenic
1143585771 17:7849454-7849476 GTGGGCTGGGCAGAAGGTGCAGG - Exonic
1144135413 17:12290486-12290508 AGGCTCTGGGGAGGAGGTGGTGG - Intergenic
1144772790 17:17769246-17769268 ACCCTCAGGGCTGGAGGTGCTGG + Intronic
1145122103 17:20269374-20269396 ATGTGCTGGGCAGAAGGGGCTGG + Intronic
1147325143 17:39666438-39666460 ACGCTCTAGGCAGAAGAAGCTGG + Exonic
1148352797 17:46952536-46952558 AAGATATGGGCAGAAGTTGCTGG + Intronic
1151947497 17:77327537-77327559 ATGCTCTGGGCAGTGGGGGCTGG + Intronic
1151977214 17:77489669-77489691 ACTCTGTGGGCACCAGGTGCAGG + Intronic
1151997428 17:77618743-77618765 ACATTCTGGACAGAAGGTGAAGG - Intergenic
1152812848 17:82390556-82390578 AGGCTCTGGGCAGATGGGGCAGG - Intronic
1152936204 17:83138481-83138503 ACAGTCTGGGCAGAAGGTGAAGG + Intergenic
1152999797 18:443958-443980 ACGATCATGGCAGAAGGTGAAGG - Intronic
1153603709 18:6809529-6809551 ACAATCAGGGCAGAAGGTGAAGG + Intronic
1154216764 18:12421172-12421194 AGGCTGGGGGCAGCAGGTGCAGG - Intronic
1156361361 18:36387140-36387162 AGACTGTGGGCAGAAGGTGTTGG + Intronic
1158554892 18:58466853-58466875 ACACTCATGGCAGAAGGTGAGGG - Intergenic
1158851466 18:61499228-61499250 ATCCTCTCGGGAGAAGGTGCTGG + Exonic
1158890917 18:61871001-61871023 CCTCTCTGGGAAGCAGGTGCAGG - Intronic
1159015801 18:63100861-63100883 ACGGTGTGGGCAGATGGTGTTGG - Intergenic
1160086544 18:75781922-75781944 ACTGGCTGGGCAGACGGTGCTGG + Intergenic
1160155422 18:76429993-76430015 AAGCTCTGAACAGAAGGTTCTGG - Intronic
1161495605 19:4584344-4584366 CCGCACTGGGAAGAAGGTGTCGG - Intergenic
1161874511 19:6897446-6897468 ATGCTCAGGGCAGACGCTGCTGG - Exonic
1161874647 19:6898604-6898626 ATGCTCAGGGCAGACGCTGCTGG - Intronic
1162038619 19:7955991-7956013 ACGCTCTGGGCAGCAGGGGCAGG - Intergenic
1163405292 19:17118261-17118283 GCGCTCTGGACAGAATCTGCAGG + Intronic
1163702920 19:18795585-18795607 ATGCTCTGGCCAGGAGGTCCTGG - Intergenic
1164859310 19:31550195-31550217 ACAATCAGGGCAGAAGGTGAAGG - Intergenic
925047321 2:782624-782646 ACGCTCTGCAGAGAATGTGCCGG - Intergenic
925900931 2:8508943-8508965 AAGCTCTGGGCAGCAGGGACAGG + Intergenic
926229160 2:10989837-10989859 ACGCTCATGGCTGAAGGTGAAGG - Intergenic
926498130 2:13616967-13616989 CCGCCCTGTGAAGAAGGTGCCGG + Intergenic
932021207 2:68088669-68088691 ACTGTCTGTTCAGAAGGTGCTGG + Intronic
932569598 2:72931637-72931659 AGGCTCTGGGCACAGGCTGCTGG - Intronic
933948938 2:87311853-87311875 ACCCGCTGGGCAAAAGCTGCAGG - Intergenic
936117495 2:109713660-109713682 ACTCTCTGGGCACAAGGATCAGG - Intergenic
936331261 2:111549743-111549765 ACCCGCTGGGCAAAAGCTGCAGG + Intergenic
936699520 2:114994241-114994263 AAACTCTGGGCAGAAGATGTGGG + Intronic
937847283 2:126594881-126594903 AGGCACTGGGCAGAAGCTGGAGG - Intergenic
939884079 2:147662267-147662289 ACACTCATGGCAGAAGGTGAAGG + Intergenic
944132112 2:196357835-196357857 ACGATCATGGCAGAAGGTGAAGG - Intronic
944280209 2:197886829-197886851 TAGCTCGGGGCAGTAGGTGCTGG + Intronic
944390849 2:199217848-199217870 ACACTCATGGCAGAAGGTGAAGG - Intergenic
946100060 2:217312837-217312859 GCACTCTAGGCAGAAGGTACAGG + Intronic
946874693 2:224115619-224115641 ACAATCGTGGCAGAAGGTGCAGG - Intergenic
947446096 2:230163700-230163722 ACTCTCTGAGCTGTAGGTGCAGG - Intergenic
948989917 2:241548500-241548522 AAGGTCTGGGGAGAAGGTGGAGG + Intergenic
1170593972 20:17791866-17791888 ATACTCTGGGCAGAGGTTGCAGG - Intergenic
1170688297 20:18588352-18588374 CGGCTCTCGGCAGAGGGTGCAGG + Intronic
1171352930 20:24518618-24518640 ACGCTCTGGGCAGAAGGTGCTGG + Intronic
1172082991 20:32357660-32357682 ACGCTCTAGGCTGCTGGTGCAGG + Intergenic
1173511162 20:43629598-43629620 AGGCTCTTGGCAGAAAGTGGGGG - Intronic
1173733243 20:45342639-45342661 AAGGTCTGGGCTGAAGGTGGGGG + Intronic
1174531337 20:51216992-51217014 ACAATCAGGGCAGAAGGTGAAGG + Intergenic
1174721586 20:52818668-52818690 ACTTTCTTGGCAGAAGGTGATGG - Intergenic
1175129006 20:56775162-56775184 ACAATCAGGGCAGAAGGTGAAGG - Intergenic
1175331000 20:58163811-58163833 ACGCTGTGGCCAGGAGGCGCGGG - Intergenic
1177327632 21:19612738-19612760 ACCATCTTGGCAGAAGGTGAAGG - Intergenic
1179194760 21:39154720-39154742 ACAATCATGGCAGAAGGTGCAGG + Intergenic
1179478545 21:41663372-41663394 ACAGTCTTGGCAGAAGGTGAAGG - Intergenic
1179707849 21:43192658-43192680 AAGCTCTGGGCAGAAGCTCTGGG - Intergenic
1179707860 21:43192722-43192744 AAGCTCTGGGCAGAAGCTCTGGG - Intergenic
1180068141 21:45423058-45423080 ACACTCTGGGAAGGAGATGCGGG - Intronic
1180127049 21:45800013-45800035 AAGCTGTGGGCAGAGGGCGCGGG - Intronic
1180181189 21:46119347-46119369 ATGCCCTGGGCAGCTGGTGCTGG - Intronic
1181615268 22:24049917-24049939 ACAGTCTGGGCAGGAGGGGCAGG - Intronic
1182110093 22:27717129-27717151 ACGCTCATGGCAGAAGATGAAGG + Intergenic
1182373893 22:29832007-29832029 ATGCTTTGGGGGGAAGGTGCAGG + Intronic
1182547872 22:31086016-31086038 ACCCTCTGTACAGAAGGGGCTGG + Intronic
1182651341 22:31853742-31853764 CCAGTCTGGGCAGCAGGTGCTGG + Intronic
1184897697 22:47421296-47421318 ACGATGTGGGCACAAAGTGCAGG - Intergenic
1184948161 22:47818805-47818827 AGGCTAAGGGCAGAAAGTGCAGG + Intergenic
1185214051 22:49588292-49588314 ACCATCTGGGCAGAGGGTCCAGG - Intronic
949221506 3:1639450-1639472 AGCCTCTTGGCAGAAGGTGAAGG - Intergenic
949813973 3:8038963-8038985 ACGATCATGGCAGAAGGTGAAGG + Intergenic
949947732 3:9203568-9203590 AGGGTGTGGGCAGAGGGTGCAGG - Intronic
950451953 3:13070491-13070513 AAGGTCTGAGCAGCAGGTGCTGG + Intronic
950638741 3:14334184-14334206 ACACTCTGGGCAGAGGGGGCTGG - Intergenic
953500800 3:43431933-43431955 AAGCTCTGGGCAGAACCTCCTGG - Intronic
953980870 3:47412425-47412447 AGGATCTGGGCAGATGGGGCTGG + Intronic
956937247 3:74117086-74117108 ACATTCTAGGCAGAAGGAGCAGG - Intergenic
959155209 3:102658665-102658687 AATCTCTGGGCAGAAGTTGAGGG + Intergenic
961549549 3:127661188-127661210 AGGCTCTGTGAAGAAGGTACAGG - Intronic
962257008 3:133878923-133878945 GCTCTGTGGGCAGAAGGAGCAGG + Intronic
963738795 3:149053446-149053468 ACACTCTTGGCAGAAGGTGATGG - Intronic
964624266 3:158744240-158744262 CTGGTCTGGGCAGAAGGTGTGGG + Intronic
965711785 3:171563121-171563143 AAGTTCTGTGCAGAACGTGCAGG + Intergenic
966052157 3:175632343-175632365 ACAATCTTGGCAGAAGGTGAAGG - Intronic
968503051 4:960092-960114 CCGCCCTGGGCAGCAGGTGTGGG - Exonic
968700388 4:2054283-2054305 ACACTCACGGCAGAAGGTGAAGG + Intergenic
968922018 4:3527246-3527268 GAGCTCTGGGGAGAAGGGGCTGG - Intronic
968922751 4:3531107-3531129 ACGCTCTGGGCTGGAGCGGCAGG - Intronic
969463893 4:7343525-7343547 AGGCTCTGTGCAGAGGGAGCAGG - Intronic
969465440 4:7353606-7353628 ACGCTCAGGGCAGGAGGCCCAGG - Intronic
969591961 4:8127194-8127216 ACGCTGTGGTCAGTGGGTGCTGG + Intronic
969647501 4:8441011-8441033 AGGCTCGGAGCAGAAGGAGCGGG + Exonic
972200109 4:36703725-36703747 ACAATCATGGCAGAAGGTGCAGG - Intergenic
972292552 4:37703420-37703442 ACATTCTGGGCAGGAGGGGCGGG + Intergenic
973806150 4:54527842-54527864 ACTCGCTGGTCGGAAGGTGCAGG - Intergenic
974834728 4:67234117-67234139 ACAATCATGGCAGAAGGTGCAGG - Intergenic
975432493 4:74310688-74310710 ACCCTCTGGGCAGGAGGAGGAGG - Intronic
980117653 4:128695187-128695209 ACGATCATGGCAGAAGGTGAAGG + Intergenic
981356733 4:143798233-143798255 ACGTTCATGGCAGAAGGTGAAGG + Intergenic
981378054 4:144039101-144039123 ACGATCATGGCAGAAGGTGAAGG + Intergenic
985747725 5:1656509-1656531 GCGCTGTGGGCAGAAGGTGGGGG + Intergenic
985894593 5:2740785-2740807 AGACCCTGGGCCGAAGGTGCGGG - Intergenic
986348065 5:6852891-6852913 ACAGGCTGTGCAGAAGGTGCTGG + Intergenic
988454819 5:31378144-31378166 ACACTCTGGGCAGAATTTGGGGG + Intergenic
989132900 5:38125233-38125255 ACACTCAAGGCAGAAGGTGAAGG + Intergenic
989134800 5:38143151-38143173 ACTCTGTCTGCAGAAGGTGCTGG + Intergenic
991136383 5:63186514-63186536 ACGATCATGGCAGAAGGTGAAGG - Intergenic
991562833 5:67972610-67972632 ACAATCTTGGCAGAAGGTGAAGG + Intergenic
992375140 5:76181542-76181564 ACAATCTTGGCAGAAGGTGAAGG + Intronic
992420224 5:76596627-76596649 ACGATCATGGCAGAAGGTGATGG + Intronic
996402405 5:123076592-123076614 CCACTCAGGGCAGAAGGTGAAGG + Intergenic
996698383 5:126423472-126423494 ATGCGCTGGGCGGAGGGTGCAGG + Intronic
1000082117 5:157858630-157858652 ACGCTTTGGTCATAAGGGGCGGG - Intronic
1001124050 5:169003566-169003588 AGGCTCAGGGCAGAAGCTGAAGG + Intronic
1002059234 5:176616683-176616705 AGGCTCTGGGCTGAGGGTGGGGG - Intergenic
1002576107 5:180175064-180175086 GAGCCCTGGGCAGCAGGTGCTGG - Intronic
1003248239 6:4402112-4402134 GCGCTCTGGGAAGAGGCTGCTGG - Intergenic
1003318784 6:5034604-5034626 CCGCTCATGGCAGAAGGCGCAGG - Intergenic
1003473937 6:6463819-6463841 ACGATCATGGCAGAAGGTGAAGG - Intergenic
1004222561 6:13759202-13759224 ACGCTCTAGGCAGCACCTGCTGG - Intergenic
1007464794 6:42044178-42044200 AGGCTCCGGCCAGAACGTGCAGG - Intronic
1007621454 6:43217571-43217593 ACGCTGTTGGCAGAAGCAGCTGG - Intronic
1010676893 6:78755779-78755801 ACAGTCTTGGCAGAAGGTGAAGG - Intergenic
1011547685 6:88499221-88499243 AGGGTCTGGGCAGAGGGAGCAGG + Intergenic
1011625150 6:89277278-89277300 ACAGTCAGGGCAGAAGGTGAAGG - Intronic
1014172844 6:118298061-118298083 ACAATCTTGGCAGAAGGTGAAGG - Intronic
1014737460 6:125111125-125111147 CCACTCAGGGCAGAAGGTGAAGG - Intergenic
1014952376 6:127572057-127572079 ACATTCTGTGCAGAATGTGCAGG + Intronic
1016381234 6:143483455-143483477 ACATTCTGGGCAGAAGCTACAGG + Intronic
1017121938 6:151032310-151032332 CCACTCAGGGCAGAAGGTGAAGG + Intronic
1018651580 6:165996533-165996555 ACGATCATGGCAGAAGGTGAAGG + Intergenic
1018868805 6:167765882-167765904 CTGCTCAGGGCAGAAGGTGAAGG + Intergenic
1019700203 7:2471177-2471199 AAGTTCTTGGGAGAAGGTGCAGG + Intergenic
1020117443 7:5483767-5483789 AGACTCTGGGCAGAAGTTTCTGG - Intronic
1023235307 7:38080601-38080623 ACAATCTTGGCAGAAGGTGAAGG + Intergenic
1023369457 7:39498559-39498581 ACTCTCTGGGCAGAAAGAGTGGG + Intergenic
1023912792 7:44567366-44567388 AGGCTGTGGGCAGCAAGTGCAGG - Intronic
1026573055 7:71548634-71548656 ACGATCGTGGCAGAAGGTGAAGG - Intronic
1028303899 7:89237578-89237600 TAGCTCTAGGCAGAAGGTGCAGG + Intronic
1030209386 7:106981287-106981309 ACAATCATGGCAGAAGGTGCAGG - Intergenic
1030291732 7:107879557-107879579 CTCTTCTGGGCAGAAGGTGCTGG + Intergenic
1030350967 7:108486456-108486478 CCACTCTGGGCAGAAAGTACTGG - Intronic
1030875501 7:114808522-114808544 ACGCACTGGGGAGATGCTGCAGG - Intergenic
1031481923 7:122288625-122288647 AAGTTCTGTGCAGAATGTGCAGG + Intergenic
1033403238 7:141047168-141047190 ACGATCATGGCAGAAGGTGAAGG - Intergenic
1034462332 7:151204832-151204854 AAGCTCTGGGGAGAGGGTGGCGG + Exonic
1034490964 7:151392832-151392854 ATGCACTGGTCAGAAGGTTCTGG - Intronic
1035109109 7:156465417-156465439 CCTCTCTGGGCAGAGGGTGCAGG - Intergenic
1035235368 7:157494473-157494495 TCACTCTTGGCAGAAGGTGAAGG + Intergenic
1035443650 7:158924378-158924400 GCGCTGTGGACTGAAGGTGCAGG + Intronic
1035556267 8:569390-569412 CCGGTCTGGGAAGAGGGTGCTGG + Intergenic
1035785123 8:2253931-2253953 AGGCTCTGGGTAGCAGATGCTGG - Intergenic
1035807688 8:2467785-2467807 AGGCTCTGGGTAGCAGATGCTGG + Intergenic
1035982782 8:4391873-4391895 AAGCTCTCGGCAGAAGCTGGTGG - Intronic
1037760303 8:21737602-21737624 CTGCTCAGGGCTGAAGGTGCCGG - Intronic
1042801728 8:72725713-72725735 ACAGTCTGGGCAGAAGGACCGGG - Intronic
1049213673 8:141398111-141398133 AAGCCCTGGGCAGAAGGCACAGG - Intronic
1049234488 8:141505661-141505683 ATGCTCTGGGCAGAGGGGCCAGG - Intergenic
1049457777 8:142702480-142702502 TCCCTGTGGGCAGAATGTGCTGG - Intronic
1049674147 8:143882421-143882443 ACGCTCTGGGCTGGAGCTGCTGG - Intergenic
1050432959 9:5580654-5580676 ACAATCATGGCAGAAGGTGCAGG + Intergenic
1055018588 9:71645386-71645408 CCCCTCTGGGCAGCAGGTGAAGG + Intergenic
1056543141 9:87591812-87591834 AAGCTCTGAGCAGAAGTGGCTGG - Intronic
1058248275 9:102658588-102658610 AAGATCTGGGGACAAGGTGCAGG - Intergenic
1058735336 9:107888944-107888966 AGGCCCTGGGCAGAAGGAGAGGG - Intergenic
1059277421 9:113108262-113108284 ACGCTCTGAGCACAAAGTCCTGG - Intergenic
1059278830 9:113116289-113116311 ACGCTCTGAGCACAAAGTCCTGG + Intergenic
1059330010 9:113528929-113528951 ACCCTCTGGGCATCAGGTACTGG - Intronic
1060404425 9:123366170-123366192 AGGCGCGGGGCAGAAGGGGCAGG + Intronic
1062592546 9:137280765-137280787 GCGCTCTGCGCAGAGGGTGCGGG - Exonic
1185604702 X:1361396-1361418 ACGATCACGGCAGAAGGTGAAGG + Intronic
1185837542 X:3359445-3359467 ATGCTAAGGGAAGAAGGTGCCGG - Intergenic
1188674095 X:32917215-32917237 ACAATCTTGGCAGAAGGTGAAGG - Intronic
1189292868 X:39898059-39898081 ACGATCTGGGGAGAAGTTGGGGG + Intergenic
1190082169 X:47365189-47365211 ACACTTTGGGAAGAGGGTGCAGG - Intergenic
1191674408 X:63779355-63779377 ACGATCACGGCAGAAGGTGAAGG + Intronic
1192274018 X:69611625-69611647 TCGCTCATGGCAGAAGGTGAAGG - Intergenic
1194278290 X:91914092-91914114 AGGCTCTGGGCTGATGCTGCAGG - Intronic
1195747262 X:108131303-108131325 ACGCTGTGGACAGATGATGCTGG + Exonic
1199813033 X:151370084-151370106 AAGCACTGGGATGAAGGTGCTGG + Intergenic
1199998679 X:153044737-153044759 AGGCTCTGGGAGGAAGGAGCTGG - Intergenic
1200595626 Y:5136168-5136190 AGGCTCTGGGCTGATGCTGCAGG - Intronic