ID: 1171354308

View in Genome Browser
Species Human (GRCh38)
Location 20:24532461-24532483
Sequence AAGGAACCACATCATGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171354297_1171354308 21 Left 1171354297 20:24532417-24532439 CCATAGAGACAGAAAGTAGATCA 0: 9
1: 144
2: 576
3: 1028
4: 1516
Right 1171354308 20:24532461-24532483 AAGGAACCACATCATGGGCATGG 0: 1
1: 0
2: 0
3: 11
4: 190
1171354305_1171354308 -9 Left 1171354305 20:24532447-24532469 CCAGGGGCTGGGGAAAGGAACCA 0: 1
1: 0
2: 8
3: 93
4: 620
Right 1171354308 20:24532461-24532483 AAGGAACCACATCATGGGCATGG 0: 1
1: 0
2: 0
3: 11
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171354308 Original CRISPR AAGGAACCACATCATGGGCA TGG Intronic
900401798 1:2475781-2475803 AGGGACCCACATCCTGGGCCTGG + Intronic
900429355 1:2594558-2594580 AAGGAACCAGATCTTGGGATAGG - Intronic
901642131 1:10697986-10698008 AAGGCACCACGGCATGGCCACGG + Intronic
901661279 1:10799406-10799428 AAGGAACCTCATCTCGGGTAGGG + Intergenic
901883092 1:12205326-12205348 AAGGAACCCCATCAAGGTCTTGG + Intronic
904031365 1:27535508-27535530 GAGGAATGACATCATGGGGAGGG + Intronic
905197599 1:36292563-36292585 AAAGAAACACATTATGGGCCAGG - Intronic
908888218 1:68814409-68814431 AAGAAACCACGGCAAGGGCAAGG + Intergenic
913351612 1:117867396-117867418 AAGGAAATACAGGATGGGCACGG + Exonic
914847750 1:151292280-151292302 GAGGTTCCCCATCATGGGCAAGG - Exonic
916297761 1:163238710-163238732 AAGGAGCCACATCAAGATCATGG - Intronic
917435946 1:175021427-175021449 AAATACCCACAACATGGGCATGG - Intronic
920216512 1:204364968-204364990 AAGAAGTGACATCATGGGCAGGG + Intronic
922749461 1:228063787-228063809 AGGGCACGAGATCATGGGCATGG + Intergenic
1062769806 10:90396-90418 CAGGAAGCACATCATGACCAAGG - Intergenic
1063399817 10:5732279-5732301 AAGGCAGCACATTATGGCCAAGG + Intronic
1064720771 10:18226482-18226504 AAGGAACCACAGCAGGGGACTGG - Intronic
1064985983 10:21210094-21210116 TAGGAAAAACATCATGGGCAGGG + Intergenic
1073676538 10:105653676-105653698 AAGGAAAAACATCATGAGAATGG + Intergenic
1077151871 11:1076411-1076433 AAGGCGCCCCAGCATGGGCATGG + Intergenic
1079493471 11:21014849-21014871 AAATAACCACAACAAGGGCAGGG - Intronic
1080475621 11:32588093-32588115 TAGAAACCACATCATAGGCCAGG + Intronic
1082782357 11:57297761-57297783 AAAGAACCACCGCACGGGCAGGG + Intergenic
1082936927 11:58664737-58664759 TAGGAACAATATCATGGGGAGGG + Intronic
1083329139 11:61889303-61889325 GAGGAACCCCAGCATGGGCCTGG + Intronic
1083576416 11:63795112-63795134 AAGGAACCACCTGATTGGCTTGG - Intergenic
1084283631 11:68117213-68117235 AAGGAAACACACCAAGGGAAAGG + Intronic
1084691446 11:70729399-70729421 AAGTAACTGCTTCATGGGCACGG + Intronic
1084988109 11:72895613-72895635 AAGGAACCAGATCAGGAGAAAGG + Intronic
1086963146 11:93000664-93000686 AATGAGTCACATCCTGGGCAGGG - Intergenic
1090356546 11:126144303-126144325 AAGGAGGCACATCATGGCCCAGG + Intergenic
1090576086 11:128105553-128105575 CAGGACCAACATCATAGGCATGG + Intergenic
1091666704 12:2424044-2424066 ATGGAACCACATAATGTGCGCGG - Intronic
1093170049 12:15850346-15850368 AAGGATCCATAGCCTGGGCAGGG - Intronic
1094330921 12:29292224-29292246 AAGGAACCCCATCGTGAGAAGGG + Intronic
1097434323 12:59540808-59540830 TAGGAACAATATCATGGGGAGGG - Intergenic
1097635692 12:62119489-62119511 AAGTAACCACAATATGGGAAAGG + Intronic
1097776689 12:63655483-63655505 TAGGAAATACATAATGGGCATGG + Intronic
1100803686 12:98259262-98259284 AAGGAACCCAATCATGTTCATGG + Intergenic
1100859299 12:98787627-98787649 AAGGAACCACAGGCTGGGCGTGG + Intronic
1102534668 12:113571896-113571918 AAGGAACAAGATCATGTGCTTGG - Intergenic
1103986232 12:124769309-124769331 ACGTAATCACATCATGGGAAGGG - Intergenic
1104699238 12:130889075-130889097 CAGAAACCACATCCTGGGGATGG - Intergenic
1104832637 12:131764330-131764352 ATGGAGCCACATCATATGCAGGG - Intronic
1107548457 13:41455110-41455132 TAGGAACAATATCATGGGGAGGG + Intergenic
1108698387 13:52923065-52923087 TAGGAACCAAACCATGGGGATGG + Intergenic
1109354694 13:61222195-61222217 TACGAACAAGATCATGGGCAGGG - Intergenic
1110416641 13:75260753-75260775 AAGGAAGCCCAGCCTGGGCATGG + Intergenic
1111787562 13:92809306-92809328 AATGAGCCCCATCATAGGCATGG + Intronic
1113396890 13:109956170-109956192 AAGGAGCCACATCTTGGGGGTGG + Intergenic
1115648862 14:35388880-35388902 CAGGAACCCCATGATGCGCAAGG - Intergenic
1116204364 14:41843768-41843790 AAGTAATCACTTCATGAGCATGG + Intronic
1116576318 14:46580756-46580778 AAGAAACCACAGCAGGGCCACGG - Intergenic
1120025041 14:79573753-79573775 AAGCAACTACATCACGGACATGG - Intronic
1120526971 14:85588554-85588576 AAATAACCACATCATGAGAATGG + Intronic
1121626849 14:95391681-95391703 AAAGAATCCCAGCATGGGCAGGG + Intergenic
1122628023 14:103094148-103094170 AAGGGACGGCATCCTGGGCAGGG - Intergenic
1124357731 15:29009204-29009226 AAGGCACCATATCTTGGGCAGGG - Intronic
1126542868 15:49841389-49841411 AGAGAGCCACATCATGGGTAGGG - Intergenic
1128235767 15:66066174-66066196 CAGGAACAAGATCATGAGCAGGG + Intronic
1137779242 16:51083691-51083713 AAATAAGCACATCATGGGAATGG - Intergenic
1138372682 16:56539874-56539896 GACGAACCACATCCTTGGCAGGG + Intergenic
1139650694 16:68360689-68360711 AAAGAAGCACTTCCTGGGCACGG - Exonic
1140433414 16:74924472-74924494 AAGAAACGACATAATGTGCAAGG + Intronic
1140787184 16:78353849-78353871 TCGGCACCACATCAAGGGCAAGG - Intronic
1142884378 17:2903720-2903742 AGGGAGCCACATCAGGGGCCTGG - Intronic
1143698645 17:8640189-8640211 AAGGAACCAAAGCATGGCAAAGG + Intergenic
1144372902 17:14609979-14610001 ATGGAACCAGATCATGAGTAGGG + Intergenic
1147813988 17:43195210-43195232 AAGTAACAACATGCTGGGCATGG + Intronic
1149513453 17:57261375-57261397 AAGAAATCCCATCATGGGGAGGG - Intronic
1150284815 17:63948791-63948813 CAGGCACCACATCATGGGCCTGG + Intronic
1150324810 17:64248379-64248401 AAGGAAACACAAGATGGGTAAGG + Intronic
1152090552 17:78244430-78244452 GAGAAACCACAGCATGGGCTGGG - Intergenic
1153280870 18:3412668-3412690 AAGGAACCACAGCCTGTGCCAGG - Intronic
1156348435 18:36281316-36281338 AGAGAACCACATCAAGGTCATGG + Intergenic
1156742915 18:40354622-40354644 AAATAACCACATCATGGAAATGG + Intergenic
1160064845 18:75565069-75565091 AGGGAACCAAAACATTGGCAGGG - Intergenic
1160154853 18:76425452-76425474 AAGGAACCACATCACAGTGAGGG + Intronic
1161913871 19:7214618-7214640 AAGGAACAAAATCAGGGGCCAGG + Intronic
1162554877 19:11380750-11380772 AAGGATTCACATCAGTGGCAGGG - Intronic
1165223079 19:34333483-34333505 CAGAAACCACATTCTGGGCATGG - Intronic
1166245908 19:41525428-41525450 TAGGAACAATATCATAGGCATGG + Intergenic
1167296282 19:48652081-48652103 AGGGAAAGACATCATGAGCATGG - Intergenic
1167757152 19:51419913-51419935 AAGGAACCACATCTTGGTTTTGG - Intergenic
925351186 2:3201586-3201608 AAGGAACCATATAGTGTGCAGGG + Intronic
927393470 2:22622634-22622656 AATGAACAACATGTTGGGCAAGG + Intergenic
930297788 2:49577296-49577318 AAGGAAACTCATCATCTGCAAGG + Intergenic
931383111 2:61771987-61772009 AAGGAAGCAAACCATGTGCAGGG + Intergenic
938367612 2:130747293-130747315 AACAAACCACAGCCTGGGCAAGG + Intergenic
938572299 2:132571720-132571742 AAGCAACAAGATCATGGGCCTGG + Intronic
940625969 2:156175622-156175644 AAGGTTCCACAGCATGGGAAGGG + Intergenic
940637553 2:156317951-156317973 AAGGAACAAAATCATTGGCATGG - Intergenic
942883214 2:180888846-180888868 TAGGAACCAGAGCATGGGAAGGG + Intergenic
946097370 2:217287067-217287089 AAGGAACCACAGAAAGGGCCTGG - Intronic
946868144 2:224060607-224060629 AAGGAACCAGAGCAAGGCCAGGG - Intergenic
947407433 2:229794177-229794199 AAGCAATCACATCATGGACTAGG - Intronic
947797374 2:232903065-232903087 AAGGCACCACATTAGTGGCAGGG + Intronic
947890888 2:233618328-233618350 ACGGAACCACATCATGCACTTGG + Exonic
947895990 2:233672555-233672577 ACGGAACCACATCATGCACTTGG + Exonic
947896872 2:233682558-233682580 ATGGAACCACATCATGCACTTGG + Exonic
948927071 2:241105966-241105988 AAGGAACCCCAGAATGGCCAAGG + Intergenic
949031928 2:241801479-241801501 AATGAACCCCATCTTGGCCAAGG - Intronic
1168844791 20:936614-936636 AGGGAACCACGTCATGGGAGTGG - Intergenic
1169450923 20:5710286-5710308 AAAGAACTACACCATGGGCCAGG + Intergenic
1169472032 20:5894839-5894861 CAGGAAGCACATCATAGGAATGG + Intergenic
1169931178 20:10834724-10834746 AAGGAAACACATGAGGGGAAAGG + Intergenic
1171354308 20:24532461-24532483 AAGGAACCACATCATGGGCATGG + Intronic
1172384487 20:34524193-34524215 AAAGAGCCACATTAAGGGCAAGG - Intronic
1173390883 20:42631697-42631719 AAGGAGCCCAATCTTGGGCAAGG + Intronic
1173775910 20:45706150-45706172 AAGGAACCAAGTCATGGCCCAGG + Intronic
1174493311 20:50919837-50919859 AAGGAACGACATGATTGGAAAGG + Intronic
1176031123 20:63012568-63012590 AAGGAAAAACAGGATGGGCATGG - Intergenic
1176173199 20:63705627-63705649 AAGGAACCTCATCAGGGGAGAGG + Intronic
1176349679 21:5782569-5782591 CAGGACCCATAACATGGGCAGGG + Intergenic
1176356493 21:5903153-5903175 CAGGACCCATAACATGGGCAGGG + Intergenic
1176544000 21:8180639-8180661 CAGGACCCATAACATGGGCAGGG + Intergenic
1176562951 21:8363684-8363706 CAGGACCCATAACATGGGCAGGG + Intergenic
1178272182 21:31201001-31201023 AAGAGACCACACAATGGGCAAGG + Intronic
1179048571 21:37869181-37869203 AAGGTGCCTCATGATGGGCATGG - Intronic
1182174741 22:28272714-28272736 AAGGGACCAAATCCTGGACAGGG + Intronic
1184209900 22:43029287-43029309 AAAGAGCCACTTCAGGGGCAGGG - Intergenic
1203248869 22_KI270733v1_random:96862-96884 CAGGACCCATAACATGGGCAGGG + Intergenic
949252031 3:1996720-1996742 TAGGAAACACCTAATGGGCAAGG + Intergenic
949864512 3:8536425-8536447 AAGGAAACACATCCTGGGGAGGG - Intronic
952995659 3:38879696-38879718 AATGAATCCCATCATGGGAAAGG + Intronic
953238337 3:41125890-41125912 AAGGAAGCAAAACACGGGCAAGG + Intergenic
954015537 3:47686688-47686710 AAGAAACCAAATTATGGGCTGGG + Intronic
955132593 3:56185950-56185972 TAGGGGCCACATCATGTGCAAGG + Intronic
959188004 3:103071601-103071623 AAGTACCCACATGATGGGCAAGG + Intergenic
962554130 3:136528659-136528681 AAGGAACCAAGTCAGGCGCAGGG + Intronic
965768310 3:172154494-172154516 AAGAAACCATAGCCTGGGCACGG - Intronic
969450490 4:7270169-7270191 TAAAATCCACATCATGGGCACGG - Intronic
969715459 4:8866107-8866129 AAGGAACCAACTGATGGGCCGGG + Intronic
970421574 4:15910119-15910141 AATGAACCATCTCTTGGGCAAGG + Intergenic
971653226 4:29306823-29306845 TATTAACCACATCATTGGCAGGG + Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
975292608 4:72694785-72694807 AAAGAACCAGCTCCTGGGCAGGG - Intergenic
976449747 4:85174543-85174565 AAGGGAGCACATCATGGGGAAGG - Intergenic
976690834 4:87865510-87865532 AAGGAACAACATCACGGTCAAGG - Intergenic
976744223 4:88387605-88387627 AAGGAATCACACAATGGCCACGG - Intronic
977402779 4:96554962-96554984 AAACAACCAGATCATTGGCAGGG - Intergenic
980702778 4:136454650-136454672 AAGGGATGATATCATGGGCAAGG + Intergenic
981729980 4:147887050-147887072 AAGGAAACATAGCATGGGCCGGG - Intronic
981844274 4:149149548-149149570 AAAGAACAAGATCATGGGCCAGG - Intergenic
982655354 4:158141900-158141922 AAGAAACCACAACATCGGCCGGG - Intronic
982655410 4:158142237-158142259 AAGAAACCACAACATCGGCCGGG - Intronic
982867890 4:160540951-160540973 CAAGAACAACTTCATGGGCAGGG + Intergenic
983982609 4:174017250-174017272 AAGGAACAACTTACTGGGCAGGG - Intergenic
987093680 5:14529640-14529662 CAGGGACCACATTCTGGGCAGGG - Intronic
989703117 5:44294572-44294594 AAAGAACCAAAGCATGGACAGGG - Intergenic
998596719 5:143538099-143538121 AAGTAATCATATCATGTGCATGG - Intergenic
1002348927 5:178568694-178568716 AAGGAACCAGACAAAGGGCAAGG - Intronic
1005231359 6:23705104-23705126 AAGGAATAACATCCTGGCCATGG - Intergenic
1005752558 6:28896890-28896912 CAGGGACCACCACATGGGCAAGG + Intergenic
1006372611 6:33654779-33654801 AGGGATCCACAGCCTGGGCACGG - Intronic
1010731567 6:79396765-79396787 AAGGAACTGAATCATGGGCTGGG + Intergenic
1012371811 6:98516386-98516408 AAGGAACCATATCATAGTAAAGG - Intergenic
1014837254 6:126173597-126173619 AAGGAAGCAAATCATGGGGTTGG - Intergenic
1017000609 6:149994961-149994983 ATGGAATCACATCATGGCAAAGG + Intergenic
1019582963 7:1777365-1777387 AGGGTATCACATCATCGGCATGG + Intergenic
1019614357 7:1952423-1952445 AAGGAAGCAGGTCATTGGCACGG - Intronic
1019647404 7:2138500-2138522 AAGGAACCACATCAAGAGGTGGG + Intronic
1019961205 7:4461408-4461430 AGGGAACCACAAGATGGGCAGGG - Intergenic
1022361729 7:29666303-29666325 TAGGAAATACATAATGGGCACGG - Intergenic
1022699661 7:32747421-32747443 TAGGAAATACATAATGGGCATGG + Intergenic
1024726017 7:52196059-52196081 AGGTAATCAGATCATGGGCATGG + Intergenic
1024809377 7:53189641-53189663 AAGTAACCACAGGATGGGCCTGG - Intergenic
1029831565 7:103265868-103265890 TAGGAAATACATAATGGGCATGG + Intergenic
1029856122 7:103518624-103518646 CAGGAAACACATGCTGGGCATGG - Intronic
1032691997 7:134296414-134296436 GTAGAACCACATGATGGGCAGGG + Exonic
1034569947 7:151947399-151947421 AAGGAACAACATGATGGGATGGG - Intergenic
1035886920 8:3301297-3301319 AAGGAACCAGGTGGTGGGCAGGG + Intronic
1037222063 8:16536087-16536109 ATGAAAGGACATCATGGGCAAGG + Intronic
1038012777 8:23487860-23487882 AAGGAATCCCACCATGGGCCTGG + Intergenic
1038595663 8:28883463-28883485 AAGAAACAGCATCATTGGCAAGG + Intronic
1042207151 8:66340781-66340803 AAGAAACCACATTATAGTCAGGG + Intergenic
1042438769 8:68799930-68799952 CAAGAACCACAGCATGGGCAAGG + Intronic
1042440753 8:68823032-68823054 AAGGAACAAAATCAGAGGCAGGG + Intergenic
1043951786 8:86317540-86317562 AAGAAACCTCATATTGGGCAGGG + Intronic
1044064636 8:87684482-87684504 AAGGACACACATGAGGGGCATGG + Intergenic
1045565176 8:103307268-103307290 AAGGAACCATAATATGGGCCTGG - Intronic
1045924706 8:107570828-107570850 TAGGAACCACATCACAGGGAAGG - Intergenic
1047347116 8:124039163-124039185 AAGCACCCACATCACAGGCAGGG - Intronic
1047884062 8:129228460-129228482 AAATAAACACATCATGGGCCAGG - Intergenic
1048207557 8:132427391-132427413 AAGGAGTCACATCATGGTGAGGG + Intronic
1049349544 8:142157102-142157124 AAGGAACGAAATCATGGCCTTGG - Intergenic
1049374847 8:142284499-142284521 ATAGAACCACATCAGGAGCAGGG + Intronic
1049918615 9:342756-342778 AAGGAATAACAGGATGGGCATGG - Intronic
1050005258 9:1122795-1122817 AAGGCACCAGATGATGGGGAGGG - Intergenic
1052183004 9:25553856-25553878 TAGGAAACACACCATGGACAGGG + Intergenic
1053100200 9:35365311-35365333 AAGGAAACACATGGTGAGCATGG - Intronic
1055077405 9:72230200-72230222 AAGGCAGCACATGGTGGGCATGG + Intronic
1056335450 9:85564056-85564078 AAGGAACCACCACAAGGGCAAGG + Intronic
1057326255 9:94067092-94067114 AAATAACCACATCATTGGCTGGG + Intronic
1057553876 9:96072305-96072327 CAGGAACCCCATCTTGGGAAGGG + Intergenic
1059093595 9:111388494-111388516 AAGGGGCCACATTACGGGCAGGG + Intronic
1203465269 Un_GL000220v1:80110-80132 CAGGACCCATAACATGGGCAGGG + Intergenic
1187543352 X:20221924-20221946 AAGGAACCACATCAAGACCTTGG + Intronic
1190721994 X:53156437-53156459 AAATAACCACAGCATGGGCTTGG + Intergenic
1193150343 X:78118289-78118311 AAGGAACTACAGGCTGGGCATGG + Intronic
1194859373 X:98978081-98978103 GTGCAACCATATCATGGGCATGG + Intergenic
1194966900 X:100298545-100298567 AATGAACAACATCATGAACAGGG + Intronic