ID: 1171354685

View in Genome Browser
Species Human (GRCh38)
Location 20:24534696-24534718
Sequence GGACCTAGGTGACCACCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171354685_1171354694 24 Left 1171354685 20:24534696-24534718 CCTGCTGGTGGTCACCTAGGTCC No data
Right 1171354694 20:24534743-24534765 CACTACACACTGCCTGCACACGG 0: 1
1: 0
2: 0
3: 21
4: 190
1171354685_1171354695 28 Left 1171354685 20:24534696-24534718 CCTGCTGGTGGTCACCTAGGTCC No data
Right 1171354695 20:24534747-24534769 ACACACTGCCTGCACACGGTAGG 0: 1
1: 0
2: 2
3: 20
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171354685 Original CRISPR GGACCTAGGTGACCACCAGC AGG (reversed) Intronic
No off target data available for this crispr