ID: 1171355964

View in Genome Browser
Species Human (GRCh38)
Location 20:24545588-24545610
Sequence CTCAAGACTCAGCCGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 166}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171355964_1171355977 26 Left 1171355964 20:24545588-24545610 CCCTCCCCCGGCTGAGTCTTGAG 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1171355977 20:24545637-24545659 GCTTAAATAAAAGCTAGGAATGG 0: 1
1: 0
2: 1
3: 16
4: 250
1171355964_1171355971 -10 Left 1171355964 20:24545588-24545610 CCCTCCCCCGGCTGAGTCTTGAG 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1171355971 20:24545601-24545623 GAGTCTTGAGGATGAGTAAGAGG 0: 1
1: 0
2: 1
3: 19
4: 201
1171355964_1171355974 1 Left 1171355964 20:24545588-24545610 CCCTCCCCCGGCTGAGTCTTGAG 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1171355974 20:24545612-24545634 ATGAGTAAGAGGAGGCTTGAGGG 0: 1
1: 0
2: 0
3: 29
4: 333
1171355964_1171355972 -7 Left 1171355964 20:24545588-24545610 CCCTCCCCCGGCTGAGTCTTGAG 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1171355972 20:24545604-24545626 TCTTGAGGATGAGTAAGAGGAGG 0: 1
1: 0
2: 1
3: 42
4: 336
1171355964_1171355976 21 Left 1171355964 20:24545588-24545610 CCCTCCCCCGGCTGAGTCTTGAG 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1171355976 20:24545632-24545654 GGGGAGCTTAAATAAAAGCTAGG 0: 1
1: 0
2: 2
3: 10
4: 127
1171355964_1171355978 27 Left 1171355964 20:24545588-24545610 CCCTCCCCCGGCTGAGTCTTGAG 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1171355978 20:24545638-24545660 CTTAAATAAAAGCTAGGAATGGG 0: 1
1: 0
2: 0
3: 23
4: 314
1171355964_1171355979 30 Left 1171355964 20:24545588-24545610 CCCTCCCCCGGCTGAGTCTTGAG 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1171355979 20:24545641-24545663 AAATAAAAGCTAGGAATGGGTGG 0: 1
1: 0
2: 4
3: 39
4: 411
1171355964_1171355973 0 Left 1171355964 20:24545588-24545610 CCCTCCCCCGGCTGAGTCTTGAG 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1171355973 20:24545611-24545633 GATGAGTAAGAGGAGGCTTGAGG 0: 1
1: 0
2: 0
3: 41
4: 412
1171355964_1171355975 2 Left 1171355964 20:24545588-24545610 CCCTCCCCCGGCTGAGTCTTGAG 0: 1
1: 0
2: 0
3: 7
4: 166
Right 1171355975 20:24545613-24545635 TGAGTAAGAGGAGGCTTGAGGGG 0: 1
1: 0
2: 1
3: 28
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171355964 Original CRISPR CTCAAGACTCAGCCGGGGGA GGG (reversed) Intronic
900538491 1:3190920-3190942 CTGAAGGCCCAGCCGGGGGCAGG - Intronic
901748283 1:11389129-11389151 CTGCAGACTCAGAGGGGGGAAGG - Intergenic
902446045 1:16465226-16465248 CTGAAGACCCAGCCAAGGGATGG - Intergenic
903191788 1:21660627-21660649 CTCAAGACTGAGTCGGGGCTGGG - Intronic
903362161 1:22783595-22783617 CAAAAGACTCAGCAGTGGGAAGG + Intronic
903732390 1:25506009-25506031 CTCAAGTCAAAGTCGGGGGATGG + Intergenic
903971539 1:27122196-27122218 CACCTGACTCAGCCTGGGGAGGG - Intronic
904200893 1:28818433-28818455 CTCCAGACCCAGCCAGAGGAGGG + Intronic
904550149 1:31309600-31309622 CTCAAAACTCAGGCTGGGTATGG - Intronic
906568780 1:46818869-46818891 CTCCACACCCAGCCTGGGGAGGG - Exonic
910935364 1:92482229-92482251 CTCGAGTCCCGGCCGGGGGAAGG - Intronic
916299744 1:163260491-163260513 TTACAGACTCAGCAGGGGGAGGG + Intronic
918002435 1:180510087-180510109 TTAGAGACTCAGCAGGGGGAGGG - Intergenic
923880903 1:238103176-238103198 TTAGAGACTCAGCAGGGGGAAGG - Intergenic
1063163006 10:3433466-3433488 CTCAAGAATGAGACAGGGGAAGG + Intergenic
1070563383 10:77584747-77584769 CTCAAGAGTGAGCTGGGAGAAGG + Intronic
1074886942 10:117701285-117701307 GTCAAGACTCATCCTCGGGAGGG + Intergenic
1075895221 10:125989203-125989225 CTTAAAACTCAGCCGGCTGAAGG - Intronic
1075925376 10:126247537-126247559 CTCAGGACTGAGCCGGGCGCTGG - Intronic
1076497441 10:130906155-130906177 CTCTGGACTCAGCAGGTGGAAGG - Intergenic
1077564167 11:3285918-3285940 CTGAAGGCTCAGCAGGGGAAGGG - Intergenic
1077570057 11:3331735-3331757 CTGAAGGCTCAGCAGGGGAAGGG - Intergenic
1078673335 11:13385091-13385113 TTTGAGACTCAGCCAGGGGAAGG + Intronic
1080552745 11:33387803-33387825 GTAAAGACACAGACGGGGGATGG - Intergenic
1083998737 11:66284712-66284734 CTGGAGACGCTGCCGGGGGACGG + Exonic
1084183417 11:67457747-67457769 CTCAGGTCTCAGCCTTGGGAAGG + Intronic
1084366534 11:68704984-68705006 CTCCAGTCTCTGCCGGGGGCCGG + Intergenic
1084900551 11:72306941-72306963 CTCAAGAGTCAGGCAGGGCAAGG + Intronic
1085336515 11:75700893-75700915 ATCAGGGCTCAGACGGGGGAAGG + Intergenic
1085472891 11:76769376-76769398 CTCAAATCTCAGCCGGGCCAGGG - Intergenic
1086810674 11:91306371-91306393 CCCAAGTCTCAGCCTGGTGATGG + Intergenic
1090610439 11:128466340-128466362 CCAAAGACTCATCCGGGGGAAGG - Intronic
1090839998 11:130479147-130479169 CTGCAGACTCAGCCCAGGGAGGG - Intergenic
1091225945 11:133956554-133956576 CCCAAGCCTCACCCGCGGGAAGG + Intronic
1097013950 12:55972180-55972202 CTGAAGACTCAGCCCGGGTGGGG + Exonic
1103240369 12:119408395-119408417 TTCAAGACTCAACAGGGAGACGG + Intronic
1104388238 12:128369688-128369710 CTCAAGTTTCAGCCTTGGGATGG + Intronic
1105884209 13:24628187-24628209 GTCAACACCCAGCCTGGGGAAGG - Intergenic
1109940797 13:69361373-69361395 TTGAAGACTCAGAAGGGGGAAGG + Intergenic
1113541672 13:111114700-111114722 CTTCAGACCCTGCCGGGGGAAGG - Intronic
1119178647 14:72588573-72588595 CTCATTACTCAGAAGGGGGAAGG - Intergenic
1120018918 14:79505953-79505975 CTAAAGACTCAACAGGGGAAGGG + Intronic
1122003393 14:98683124-98683146 CTCAAGTCTCAGCCCACGGATGG + Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124404714 15:29382938-29382960 CTCAGCCCTCAGCCGGGTGATGG - Intronic
1124492175 15:30164726-30164748 GTCCAGCCTCAGCCGAGGGAAGG - Intergenic
1124751361 15:32373591-32373613 GTCCAGCCTCAGCCGAGGGAAGG + Intergenic
1127872289 15:63083531-63083553 CTCCAGCCTCAGCCCTGGGACGG + Intergenic
1130171573 15:81520219-81520241 CTTAAGACTCACCTTGGGGAGGG - Intergenic
1130388568 15:83434627-83434649 CACAAGTGTCAGTCGGGGGAAGG + Intergenic
1132980769 16:2737780-2737802 CCCCAGTCTCAGCAGGGGGATGG + Intergenic
1134282208 16:12827138-12827160 CTGAAGACTCAGCTGGGGAAAGG + Intergenic
1137271335 16:46904211-46904233 GTCAAGAGTCAGCGTGGGGAGGG + Intronic
1142291814 16:89196530-89196552 CTCCAGAGTGAGCAGGGGGAAGG + Intronic
1142324089 16:89402868-89402890 CTCCAGGCTCTCCCGGGGGAAGG + Intronic
1143028881 17:3956337-3956359 CTCAAAACTCACACGGGGGCCGG - Intronic
1144451258 17:15381176-15381198 CTCAAGATTCAGGCAGGGCACGG - Intergenic
1148776121 17:50096561-50096583 CTCAAGACTCAGGCAGGGCAGGG - Intronic
1149685669 17:58533146-58533168 GTCAGAACTCAGCCAGGGGAGGG + Intronic
1149987285 17:61356927-61356949 GTCCTGACTCAGCCGGGGGCAGG - Intronic
1151889430 17:76943431-76943453 CCCAAGAGTCACCCGGGGGGAGG + Intronic
1151929762 17:77224885-77224907 AGCAAGACACAGCCAGGGGAAGG + Intergenic
1203173075 17_GL000205v2_random:169497-169519 CTGAAGACTGAGCTAGGGGAGGG - Intergenic
1155771342 18:29704342-29704364 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
1156485752 18:37464548-37464570 CTCAGGACTCTGCCTGGGGTGGG + Intronic
1157324937 18:46662156-46662178 CTCAGAACTCCTCCGGGGGATGG + Intergenic
1159794214 18:72822228-72822250 CTCAAGTCTCAGAGGGTGGAGGG + Intronic
1160027176 18:75228070-75228092 CTTGAGACACAGCCAGGGGAGGG + Intronic
1161078787 19:2300326-2300348 CTAAAGAATCAGCCTGGGGCCGG - Intronic
1161179793 19:2872219-2872241 CTCTAAACTCCCCCGGGGGAAGG + Intronic
1162103097 19:8352515-8352537 CTCAAGCCTCAGCCTGGGACAGG - Intronic
1162752076 19:12835038-12835060 CCCAAGATTCAGGCTGGGGATGG - Intronic
1162932140 19:13962589-13962611 CTCCAGCCTCAGCCAGGGCAGGG - Exonic
1164443850 19:28300544-28300566 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1166453772 19:42923170-42923192 CTCTAAACTCCGCCGGGGAAAGG + Intronic
1167691752 19:50989258-50989280 CTGGAGACTCAGAAGGGGGAGGG - Intergenic
926171448 2:10555396-10555418 CTAAACACACAGCCAGGGGAAGG + Intergenic
926396758 2:12450853-12450875 TTCCCCACTCAGCCGGGGGATGG + Intergenic
928320328 2:30278174-30278196 CTGAAGGCTCAACCAGGGGAAGG - Intronic
931252655 2:60547760-60547782 CTCAATATTCAGCCTGGGTAGGG - Intronic
933709381 2:85314483-85314505 CTCAGGACTCAGCTGGAGGGAGG - Intergenic
934888991 2:98049189-98049211 CTCTAGACTCCGTCTGGGGAAGG + Intergenic
937128870 2:119491840-119491862 CCCATGACTCAGCCTGGTGAGGG - Intronic
948295410 2:236856752-236856774 CTCTAGACACTGCCTGGGGAGGG - Intergenic
948637637 2:239349615-239349637 CCCACGTCTCAGGCGGGGGATGG - Intronic
1171355964 20:24545588-24545610 CTCAAGACTCAGCCGGGGGAGGG - Intronic
1173862334 20:46292209-46292231 CTCAACACTCACCCTGGGGGAGG - Intronic
1174876884 20:54236289-54236311 CTCAAGGCTCAGCTGCGGGAAGG + Intergenic
1175047587 20:56121886-56121908 CTCTAGACTCAACTGGGGAAGGG - Intergenic
1175778295 20:61666670-61666692 CTCAGGGCTCTGCAGGGGGATGG - Intronic
1175870656 20:62208075-62208097 CTCAACACCCAGCCGGGCCACGG - Intergenic
1176329058 21:5531139-5531161 CTGAAGACTGAGCTAGGGGAGGG - Intergenic
1176398699 21:6289812-6289834 CTGAAGACTGAGCTAGGGGAGGG + Intergenic
1176438458 21:6699292-6699314 CTGAAGACTGAGCTAGGGGAGGG - Intergenic
1176462720 21:7026362-7026384 CTGAAGACTGAGCTAGGGGAGGG - Intergenic
1176486281 21:7408140-7408162 CTGAAGACTGAGCTAGGGGAGGG - Intergenic
1177909486 21:27013001-27013023 CTCAAGATTCAGCAGCTGGATGG - Intergenic
1178701896 21:34840951-34840973 CTCTGGACTCAGCCTTGGGATGG - Intronic
1179189136 21:39108408-39108430 CTGAAGCCTCAGTTGGGGGAAGG - Intergenic
1184596760 22:45518627-45518649 CTCACCACTCAGCGGGTGGAGGG - Intronic
950042856 3:9931307-9931329 CTGAAGACTGAGCTAGGGGAAGG + Intronic
950449397 3:13057227-13057249 CTGAAGACACAGCCAGGGGATGG + Intronic
952875581 3:37941748-37941770 CCCAAGGCTCAGCCCGGGGCAGG - Intronic
954243374 3:49311451-49311473 CTCAAGATACAGCCTGGGAAAGG + Intronic
956743710 3:72294871-72294893 CTCAAGGCTGAGCAAGGGGAGGG - Intergenic
963874602 3:150461286-150461308 CTAAACAATCAGCTGGGGGAAGG - Exonic
966007425 3:175033080-175033102 CTCAAAGCTCAAGCGGGGGATGG + Intronic
966464299 3:180212814-180212836 CTGGAGACACAGCCTGGGGATGG - Intergenic
967971119 3:195000225-195000247 CTCTAGCCAAAGCCGGGGGAAGG - Intergenic
968487886 4:872684-872706 CTCAAGGGGCAGCTGGGGGAGGG - Intronic
968930644 4:3576848-3576870 ATCAAGACTCAGCCGTGGAGAGG - Exonic
969238849 4:5886993-5887015 CTCAAGACTCAGCCCAGAGCTGG + Intronic
969613484 4:8239712-8239734 CCCCAGACTCAGCCTGGGGTGGG - Intronic
971381097 4:26098703-26098725 CTGAAGGCTCAGCTGGGGAAGGG + Intergenic
972210527 4:36831231-36831253 CTCAAGACTAAGCCGAGAGAAGG - Intergenic
975387120 4:73770478-73770500 CTCCAGACTCAGCCAGCAGAGGG + Intergenic
975818497 4:78244882-78244904 CAGAAGACTCAGGTGGGGGATGG - Intronic
981398037 4:144277611-144277633 TTCAAGATTCAGCCAAGGGAAGG - Intergenic
981701163 4:147608830-147608852 CTCAGAACTCAGCCAGTGGACGG - Intergenic
989253117 5:39338732-39338754 TTGAAGACTCAGCTGTGGGATGG + Intronic
997834634 5:137182334-137182356 GTTAAGATTCAGCCTGGGGAAGG - Intronic
999305426 5:150516243-150516265 CCCAGGACTCAGGCAGGGGAGGG - Intronic
1001993291 5:176134538-176134560 CTCAAGAGGCAGCTAGGGGATGG - Intergenic
1003369577 6:5511051-5511073 CTCAAGACACAGGAGGGAGAAGG + Intronic
1004984079 6:21059917-21059939 GTGAAGACTCAGAAGGGGGAGGG - Intronic
1007769315 6:44180417-44180439 CTCAAGAGTTACCAGGGGGAGGG - Intronic
1008092695 6:47309204-47309226 CTCAGGGCTCAGCCGGGGCTGGG - Intronic
1011399452 6:86943970-86943992 CTCAAGGCTCAACTGGGGAAAGG + Intronic
1015213176 6:130720899-130720921 ATCAAAATTCAGCCTGGGGATGG + Intergenic
1017564262 6:155667270-155667292 ATCAGAACTCAGCCGGTGGATGG + Intergenic
1018657976 6:166058251-166058273 CTCAAGAGTGAGCGGGGGGGGGG - Intergenic
1019475711 7:1243077-1243099 CTCAGGGCTCGGCCGGGCGAGGG + Intergenic
1024659867 7:51483189-51483211 CTCCAGACTCAGCAGGGTGGCGG - Intergenic
1028577845 7:92371922-92371944 CTCAAGACTCTCACTGGGGAAGG - Intronic
1029252174 7:99244762-99244784 CTCTAGGTTCAGCCGGGGGTGGG - Intergenic
1029446404 7:100615213-100615235 CTCAAGACCCTGCCCAGGGAGGG - Exonic
1030486643 7:110176995-110177017 CTAAAGACTCATACTGGGGAAGG + Intergenic
1031479220 7:122258063-122258085 CTATAGCCTCACCCGGGGGAAGG + Intergenic
1032075205 7:128832786-128832808 CTCCAGCCTCAGCCTGGGGCCGG - Intronic
1035130868 7:156651917-156651939 CTCAAGAGGGAGCCCGGGGAGGG - Intronic
1035422762 7:158742902-158742924 CTCCAGTCTCTGCCGGGGCAAGG + Intronic
1036576805 8:10035152-10035174 CTGGAGACTCAGAAGGGGGAAGG + Intergenic
1037612109 8:20484465-20484487 TCCAAGAGTCAGCAGGGGGAAGG - Intergenic
1039422315 8:37453519-37453541 CACTGGACTGAGCCGGGGGAGGG + Intergenic
1039558831 8:38496626-38496648 CTTAGGACTCAGCCTGGTGAGGG - Intergenic
1039646729 8:39292886-39292908 CTCCAGCCTCAGCCTGGTGATGG - Intergenic
1041240856 8:55847999-55848021 CTCATGACTCAGCCTGAGGCGGG - Intergenic
1041976798 8:63808546-63808568 CTCCATACTCAGCCAAGGGAAGG - Intergenic
1048129519 8:131678917-131678939 TTCAAGACTCAGTGGGAGGATGG + Intergenic
1049506710 8:143005311-143005333 CTCAAGACTGAGCCAGGGCCAGG - Intergenic
1049683045 8:143928200-143928222 CTCAGGACCCAGCCTGGAGAGGG + Intronic
1049850009 8:144826096-144826118 CTCTAGACTCAGCCGGGCAGTGG + Intergenic
1050937257 9:11413914-11413936 CCCCAGACTCAGCTAGGGGATGG + Intergenic
1051012558 9:12436252-12436274 CAAAAGACTCAGAAGGGGGAAGG - Intergenic
1053487411 9:38470431-38470453 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1056040477 9:82660456-82660478 CTCAAGGCTCCACTGGGGGAGGG + Intergenic
1056910682 9:90697397-90697419 CTCATGACCCAGCAGTGGGAGGG - Intergenic
1059492157 9:114676934-114676956 CTCAGCACTCAGCCCAGGGATGG + Intergenic
1060092585 9:120756337-120756359 CTCAAGACATAGTCGGGTGAGGG + Intronic
1060813145 9:126621214-126621236 GTCAAGCCTCAGCCAGGGGAGGG + Intronic
1061062794 9:128259006-128259028 CTCATGGCTCACCCTGGGGAAGG - Exonic
1062474624 9:136720899-136720921 CTCCTGCCTCAGCCTGGGGAAGG + Intronic
1203433037 Un_GL000195v1:109183-109205 CTGAAGACTGAGCTAGGGGAGGG + Intergenic
1189324841 X:40105983-40106005 CTCTAGCCTCCGGCGGGGGACGG + Intronic
1190236192 X:48617472-48617494 CTCAAGACTCAGTTGAGGGTTGG + Intergenic
1192314124 X:70038897-70038919 CTCCAGACTCAGCAGAGTGAGGG + Exonic
1192434333 X:71133622-71133644 TTCAAGACTCAGGCTGGGCACGG - Intronic
1193460316 X:81783798-81783820 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1194089909 X:89572931-89572953 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1195907601 X:109861052-109861074 CTGAAGGCTCAGCTTGGGGAAGG - Intergenic
1198417189 X:136432612-136432634 CTGGAGACTCAGAAGGGGGAAGG - Intergenic
1198661753 X:138976533-138976555 ATAAAGACTCAGAAGGGGGATGG + Intronic
1200442560 Y:3228985-3229007 TTAAAGACTCAGAAGGGGGAGGG - Intergenic
1201529348 Y:14975241-14975263 CTCACTCCTCAGCCTGGGGATGG - Intergenic