ID: 1171358564

View in Genome Browser
Species Human (GRCh38)
Location 20:24569244-24569266
Sequence AAATCCAGGCAGCGTGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171358560_1171358564 29 Left 1171358560 20:24569192-24569214 CCACAGGAGGAGAATTTCTGTAT No data
Right 1171358564 20:24569244-24569266 AAATCCAGGCAGCGTGTGACAGG No data
1171358562_1171358564 2 Left 1171358562 20:24569219-24569241 CCAAAAAGGCAAGAAGAAAATAT No data
Right 1171358564 20:24569244-24569266 AAATCCAGGCAGCGTGTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171358564 Original CRISPR AAATCCAGGCAGCGTGTGAC AGG Intronic