ID: 1171358991

View in Genome Browser
Species Human (GRCh38)
Location 20:24573388-24573410
Sequence AAAGCAGCACAGGCAAAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 319}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171358991_1171358999 9 Left 1171358991 20:24573388-24573410 CCCAGCTTTGCCTGTGCTGCTTT 0: 1
1: 0
2: 0
3: 40
4: 319
Right 1171358999 20:24573420-24573442 CAAGTCCTTTAATGAGTCACGGG 0: 1
1: 0
2: 0
3: 15
4: 125
1171358991_1171358998 8 Left 1171358991 20:24573388-24573410 CCCAGCTTTGCCTGTGCTGCTTT 0: 1
1: 0
2: 0
3: 40
4: 319
Right 1171358998 20:24573419-24573441 CCAAGTCCTTTAATGAGTCACGG 0: 1
1: 0
2: 1
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171358991 Original CRISPR AAAGCAGCACAGGCAAAGCT GGG (reversed) Intronic
900378712 1:2373250-2373272 AAGGCAGCACAGGCGATGCCGGG + Intronic
900924828 1:5698230-5698252 ATAGCAGCACAGGCAAACGAAGG + Intergenic
901340587 1:8495291-8495313 ATAGGAGCAGAGGCAGAGCTGGG - Intronic
901479065 1:9511654-9511676 AAAGCGGCAGAGGCAACGCCAGG + Intergenic
901531891 1:9859028-9859050 AAAGCAGCCCAGGGACACCTTGG + Intronic
902491152 1:16781603-16781625 AAAGAACCACAGGCCAAGATAGG - Intronic
902820129 1:18938593-18938615 AAGTCAGCACAGGCAGAGCTGGG - Intronic
902991737 1:20192485-20192507 AAAGCAGCTCAGGCTAAGACAGG - Exonic
903410847 1:23141613-23141635 AAAGCACTACAGGCCAAGCAGGG + Intronic
904251526 1:29228078-29228100 AAAGCACTACAGGTCAAGCTGGG + Intronic
905074411 1:35257170-35257192 ATAGCAGCACAGGTCAAGCCAGG - Intergenic
905225895 1:36479049-36479071 AAAGAAGCCCAGGCAGAGCTTGG - Intronic
906153382 1:43600540-43600562 ACAGAAGCACAGGGACAGCTGGG - Intronic
906593013 1:47045905-47045927 ACAGCAGCAGAGGCAAGGCAAGG - Intronic
907316400 1:53575425-53575447 GGACCAGCATAGGCAAAGCTTGG - Intronic
908269607 1:62410291-62410313 AGACCACCACAGGTAAAGCTAGG + Intergenic
910103587 1:83605336-83605358 AAAGCAGGACAGAGAAGGCTGGG + Intergenic
911072666 1:93844924-93844946 AAGGCTGCACAGGGAAAGCCTGG + Intronic
912086625 1:106014174-106014196 AAAGGAGCACAGGTATAACTAGG - Intergenic
912206046 1:107510633-107510655 AAAGAAGCCAAGGCAGAGCTTGG + Intergenic
913094916 1:115507303-115507325 AACGCACCACAGGGAAAGCTGGG + Intergenic
913173047 1:116249589-116249611 AAAGCAGGACAGGGAATGCGTGG + Intergenic
915224331 1:154401563-154401585 AAAGCATCACAGTTATAGCTGGG - Intergenic
915939646 1:160110748-160110770 AATGCAGCACAGGCAGAGGCTGG + Intergenic
916169382 1:161989148-161989170 AAAGCAGCACAGGGAATACTGGG - Intronic
917680115 1:177356985-177357007 AATGCAGCAGAGGCAAACCATGG + Intergenic
918757699 1:188358115-188358137 AAAGGAGCCCAGGTACAGCTTGG - Intergenic
919744104 1:200998243-200998265 AAAGGACCACAGTCAAAGGTTGG + Intronic
921128021 1:212195411-212195433 AAAGGAGCCCAGGTATAGCTTGG + Intergenic
922228271 1:223664554-223664576 AAAACAACACAGGCAGAGCTAGG + Intronic
923448595 1:234095436-234095458 GAACCAGCACATGCAAAGGTGGG + Intronic
923462222 1:234217234-234217256 AAAATAGAAAAGGCAAAGCTTGG + Intronic
923529291 1:234800931-234800953 AAAGAACCACAGGCCAAGATAGG + Intergenic
924477446 1:244394600-244394622 GAAGCAGCACAGGGGCAGCTTGG + Intergenic
1063264756 10:4435578-4435600 AGAGCAGCTCAAGCCAAGCTTGG + Intergenic
1066591911 10:37004639-37004661 AAAGGAAAACATGCAAAGCTTGG + Intergenic
1067687493 10:48475952-48475974 ATAACAGCACAGGCAGAGGTAGG - Intronic
1067818866 10:49508780-49508802 GAAGCAGCACAGCTAAAGATGGG + Intronic
1068660470 10:59618017-59618039 TCAGCAGCACAGGCAGGGCTTGG - Intergenic
1070293571 10:75139283-75139305 AAAGCATTTCATGCAAAGCTTGG - Intronic
1071030175 10:81169503-81169525 AAATCAGCAAAGGCAAAGGTTGG - Intergenic
1072410328 10:95196019-95196041 AAAGCAGCACAGGCTGGGCTGGG - Intronic
1072508869 10:96097945-96097967 GCAGCTGCACAGGCAAAGCTTGG - Intergenic
1072752057 10:97988157-97988179 AAAGCAGCAAAGGGACAGCAGGG - Intronic
1073003984 10:100307458-100307480 AGAGCAGCATGGGCAAAACTGGG + Intronic
1073033582 10:100547551-100547573 ACAGCAGCCCTGGCACAGCTGGG - Intronic
1073844941 10:107544577-107544599 ACAGCAGGAGAGGCACAGCTAGG + Intergenic
1074024246 10:109617292-109617314 AAAGCAGAAAAGCTAAAGCTGGG + Intergenic
1074322613 10:112417086-112417108 CAAGCAGCAGAGGAAAAGCAAGG - Intronic
1075956310 10:126526063-126526085 AAAGAAGCAGAGGCAAAGAGGGG + Intronic
1076006204 10:126949548-126949570 AGAGCAGCAAGGGCAGAGCTGGG + Intronic
1076447160 10:130524567-130524589 CAAGGTGCACAGGGAAAGCTAGG - Intergenic
1076608746 10:131707084-131707106 AAAGCTGCAGAAGCAAAGCCTGG + Intergenic
1076701969 10:132277975-132277997 AAGGCAGCAGTGGCAAAGCAAGG + Intronic
1076731490 10:132441217-132441239 CAAGCAGCACAGGAAAGGCTGGG + Intergenic
1077601850 11:3580174-3580196 AAAGCCACACAGGAAGAGCTGGG + Intergenic
1078693249 11:13602996-13603018 AAAGGAGCAAAGGGAAAGCCTGG - Intergenic
1079165794 11:18041881-18041903 GAAGCACCACAGTCAAAGTTAGG + Intronic
1080272470 11:30465589-30465611 AAAGCAGAAAAGGCTAGGCTGGG - Intronic
1080593119 11:33740794-33740816 AAGACAGTACAGTCAAAGCTAGG + Intergenic
1081786754 11:45753095-45753117 AAACCAGCACAGGCCAGGCGCGG + Intergenic
1082260721 11:50074712-50074734 AAAGAAGCAAACGCTAAGCTTGG + Intergenic
1084039089 11:66531210-66531232 AAAGCAGCAGAGGCAGGGCTTGG - Intronic
1084295010 11:68207500-68207522 AAAGCAACACAGGCCAGGCACGG + Intronic
1085553841 11:77401631-77401653 AAAACAGCATAGGCAAAGGCAGG - Intronic
1086043563 11:82507111-82507133 ACAGAAACACAGGCAAAGTTTGG + Intergenic
1087205983 11:95394275-95394297 AAAGTGGCACAGGCCAGGCTCGG + Intergenic
1088960015 11:114653816-114653838 AAAGCAGGACAGGCCAGGCGCGG - Intergenic
1089060107 11:115619335-115619357 AAAGCAGAACAGAGAAAGGTGGG + Intergenic
1090457594 11:126863287-126863309 AAGACAGCACAGGCCAAGCTGGG + Intronic
1090844979 11:130522786-130522808 AGAGCAACACAGCCAGAGCTGGG - Intergenic
1091198263 11:133750248-133750270 AAAGCAGCACATTCCCAGCTGGG + Intergenic
1091244402 11:134079583-134079605 AATGAATCACATGCAAAGCTAGG - Intronic
1095612572 12:44147344-44147366 GAAGCAGCAATGGCAAAACTGGG - Intronic
1097945824 12:65366455-65366477 AAAACAGCACAGGCAGAGGAAGG + Intronic
1097974670 12:65671822-65671844 AAAGAAGGAAAGGCAAAACTAGG + Intergenic
1098005421 12:65992169-65992191 AGAACAGCACATGCAAAGCTGGG + Intergenic
1098601623 12:72338175-72338197 AAAGCTTCAGAGGAAAAGCTTGG - Intronic
1098695043 12:73541882-73541904 TAAGCAGCAAGGACAAAGCTGGG + Intergenic
1098740283 12:74165314-74165336 AAAGCAGAACAGGCCAGGCGCGG - Intergenic
1099627184 12:85090071-85090093 AAAGGAGCCCAGGCACAGCTTGG + Intronic
1101802747 12:108036513-108036535 GAAGCAGCACTTGGAAAGCTAGG - Intergenic
1102301860 12:111777152-111777174 ACAGCAGCAAAGGCAGAGCCAGG - Intronic
1103885503 12:124197334-124197356 GAAGTAGCACTGGCAGAGCTTGG - Intronic
1105259864 13:18771012-18771034 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105262544 13:18790335-18790357 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105264465 13:18803791-18803813 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105382370 13:19899520-19899542 AAAGCAGTAGAGGAAAGGCTGGG + Intergenic
1108701107 13:52945057-52945079 AAAGGAGCAAAGGGGAAGCTGGG + Intergenic
1109160443 13:58966892-58966914 AAAGCAGCACAGGAAAGGCAGGG - Intergenic
1109483196 13:62984159-62984181 AAAGTATCACAGGCAACGCTGGG - Intergenic
1111591998 13:90360279-90360301 AAAGTAGCAAAGGCAACACTAGG + Intergenic
1112457103 13:99573026-99573048 AAATCAGCACCGGCAGAACTTGG + Intergenic
1112548630 13:100397249-100397271 AAAACAGCACATCCAAACCTAGG - Intronic
1112597759 13:100824405-100824427 AAAGCAGCAGAGACAAAGGTGGG + Intergenic
1114725776 14:24935162-24935184 AAAGCAGCAAGGGCAAATGTGGG + Intronic
1115196198 14:30802510-30802532 AAAGCTGGAGAGGCAAAGTTGGG + Intergenic
1115506190 14:34096274-34096296 ACAGGAGGGCAGGCAAAGCTTGG + Intronic
1116427235 14:44806286-44806308 AAAGGAGCACAAGAAAAGTTTGG + Intergenic
1117434168 14:55700398-55700420 GAAGCAGTACAGGCAAAGAAGGG + Intronic
1117555217 14:56876932-56876954 AAAGCAGCATGTGCAAAGGTAGG + Intergenic
1119125709 14:72124332-72124354 AAACCACTACAGGCAAAGATAGG + Intronic
1119400897 14:74361528-74361550 AAAGCAGCACAAGGAATTCTAGG - Intergenic
1119451480 14:74714998-74715020 AAACCAGCTCAGGGAAAGCCTGG - Intronic
1119924200 14:78476404-78476426 AAAGCATCACAGGCCAAGTGGGG + Intronic
1120780559 14:88482176-88482198 AGAGCGGCACTGGCAAAGCCAGG + Intronic
1121248375 14:92481292-92481314 AAAGCATAAAAGGAAAAGCTGGG - Intronic
1122157789 14:99760832-99760854 CAACCAGTACACGCAAAGCTGGG + Intronic
1122773375 14:104106829-104106851 GCAGCAGCACAGGCCAGGCTGGG - Exonic
1202833982 14_GL000009v2_random:64277-64299 AAAGATGCACAGGTACAGCTTGG + Intergenic
1123955357 15:25328963-25328985 AAAGCAGGGCAGGTGAAGCTAGG + Intergenic
1124226241 15:27897438-27897460 AAAGGAGCCAAGGCAGAGCTCGG + Intronic
1124577267 15:30921028-30921050 AAAGCATCAGAGGCCAAGGTGGG - Intronic
1124621260 15:31275410-31275432 AAGGCAGAAGACGCAAAGCTGGG + Intergenic
1127639057 15:60898159-60898181 AAAGAAGCAGAGGCTCAGCTTGG + Intronic
1128002569 15:64207064-64207086 AAAGCAGCACTGTCAAGCCTGGG + Intronic
1129267892 15:74403786-74403808 AAACCAGCACATGCAAAGCATGG - Intergenic
1131423059 15:92323291-92323313 AATGCAGCACAGACACAGCACGG - Intergenic
1133418744 16:5627051-5627073 AAAGCAGCAACTGCAAAGCCGGG - Intergenic
1133980289 16:10628222-10628244 CAAGCAAGACAGGCAAGGCTCGG + Intronic
1134297422 16:12959397-12959419 ACATCAGCAGAGGAAAAGCTAGG + Intronic
1135222545 16:20625333-20625355 AAGGCTGCACAGGTAAAGCCTGG + Intronic
1136226768 16:28865144-28865166 AAAACATCACAGGGAGAGCTGGG - Intronic
1137845950 16:51688250-51688272 TAAGCAGCACAGGTAAAGATGGG - Intergenic
1138407343 16:56807101-56807123 AAAGCAGCACAAGATGAGCTTGG - Intronic
1138734967 16:59239998-59240020 AAATCAGCAAGGGAAAAGCTAGG + Intergenic
1139421299 16:66851051-66851073 AGAACAGCACAGACAAAGCTTGG - Intronic
1140206876 16:72940350-72940372 GAAGCTGCACAGGGAAATCTGGG + Intronic
1140268008 16:73436699-73436721 AGAACAGCACAGCCAAAGCAAGG - Intergenic
1140554736 16:75908936-75908958 AAAGCAGCCCAGGAGAAGCATGG - Intergenic
1148614233 17:48987217-48987239 AAAACAGCACAGGCCAGGCGTGG - Intergenic
1149644140 17:58227557-58227579 GAAACAGCAAATGCAAAGCTGGG + Intronic
1151292279 17:73159188-73159210 AAAAGAGCACAGGCAACTCTGGG - Intergenic
1151887348 17:76930931-76930953 ACAGCAGCAGGGGCAACGCTTGG + Intronic
1152306740 17:79525328-79525350 AAAGCACCACAGGCACATCATGG + Intergenic
1153551829 18:6270644-6270666 GAAGCAGCATGGGCAAAGCCAGG + Intronic
1153707072 18:7756931-7756953 GGAGCAGCACAGGCCAAGCTGGG - Intronic
1154004352 18:10514129-10514151 CCAACAGCACAGGGAAAGCTGGG - Intergenic
1154232429 18:12569355-12569377 AAAGGAGCACAGGCATAACAAGG + Intronic
1154423924 18:14257770-14257792 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154425258 18:14267223-14267245 AAAGATGCACAGGAACAGCTTGG + Intergenic
1154427992 18:14286811-14286833 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154428893 18:14293379-14293401 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154432954 18:14322462-14322484 AAAGATGCACAGGAACAGCTTGG + Intergenic
1154433847 18:14329023-14329045 AAAGATGCACAGGTACAGCTTGG + Intergenic
1155722568 18:29035575-29035597 ATACCAGCACAGGTAGAGCTGGG + Intergenic
1157086600 18:44586672-44586694 CAGGCAGCACATGCAGAGCTTGG - Intergenic
1158545192 18:58390177-58390199 AAAACAACAAAGGCAAAGATGGG - Intronic
1159049986 18:63412322-63412344 AAAGCAGCACAGGAAAAAGATGG + Intronic
1160018462 18:75162317-75162339 ATAGCAGCACTGGCCACGCTCGG - Intergenic
1160283757 18:77518890-77518912 AAAGGAGCACAGGCCAGGCGTGG - Intergenic
1161842876 19:6693436-6693458 AAGGCCGCAAAGGCAGAGCTGGG + Exonic
1165088524 19:33369153-33369175 AAAGCAGTATAAGCACAGCTTGG + Intergenic
1165371487 19:35409316-35409338 AACCCAGCACAGGCAAGTCTGGG + Intergenic
1202638700 1_KI270706v1_random:63415-63437 AAAGATGCACAGGTACAGCTTGG - Intergenic
925338568 2:3116535-3116557 AAAGCAACATAGGCAAGGCCTGG + Intergenic
925842022 2:8001401-8001423 AAAGCAGCACAGCCCAGGCCTGG - Intergenic
927302813 2:21535840-21535862 AAAGGAGCCCAGGAACAGCTCGG + Intergenic
928983740 2:37160320-37160342 AAACAAGCACAGGGATAGCTGGG - Intergenic
930711609 2:54555776-54555798 CAAGCAGCACAGTAAAAGCATGG - Intronic
931135145 2:59390857-59390879 AGAGCAGCACATGAATAGCTAGG - Intergenic
931140406 2:59451941-59451963 AAGCCAGCACAGGTACAGCTTGG + Intergenic
931239557 2:60439875-60439897 AAAGCAGCACAGGGCAAGCCGGG - Intergenic
932716269 2:74102215-74102237 AAAGCACCACAGAGACAGCTCGG - Exonic
933612429 2:84451099-84451121 AATGCAGCACTGGCAAGGGTGGG - Intronic
933730720 2:85454426-85454448 TAAGGAGCAAAGGCAAAGCTGGG + Intergenic
934491820 2:94766345-94766367 AAAGATGCACAGGTACAGCTTGG - Intergenic
934492268 2:94769491-94769513 AAAGATGCACAGGCACAGCTTGG - Intergenic
934494159 2:94782933-94782955 AAAGATGCACAGGTACAGCTTGG - Intergenic
936692686 2:114911622-114911644 AAACCAGCCAAGACAAAGCTTGG + Intronic
937492998 2:122389120-122389142 AAAACACCAAAGGCAAAGTTGGG + Intergenic
938668523 2:133564746-133564768 GGAGGAGCACAGGCAAAGCTGGG + Intronic
939125374 2:138171937-138171959 AAAGCGGCCCAGGTACAGCTTGG + Intergenic
939711993 2:145533463-145533485 AAAGAAGCACAAGCAAAGTGAGG - Intergenic
940464610 2:154012830-154012852 ACAGCAGAACAGACCAAGCTGGG - Intronic
943334423 2:186596687-186596709 AAAGCAACACAGGCCAGGCACGG - Intronic
944544878 2:200789230-200789252 AAAGCATCAAAGGTAGAGCTGGG - Intergenic
945744127 2:213699817-213699839 CAAACAGCACAGACAAAGCAGGG - Intronic
946385847 2:219384080-219384102 AAAGCAGCAGGAGCAAGGCTAGG + Intronic
946848341 2:223881026-223881048 AAAGCAGCAGAGGCAAATGTTGG - Intronic
1170801419 20:19593653-19593675 TAAACAACACAGGCAAAGCAGGG + Intronic
1171146020 20:22783495-22783517 AAAGCTGCAGAGGAAAAGTTGGG + Intergenic
1171358991 20:24573388-24573410 AAAGCAGCACAGGCAAAGCTGGG - Intronic
1171883906 20:30637708-30637730 AAAGATGCACAGGTAGAGCTTGG - Intergenic
1172174866 20:32966150-32966172 AAGGCAGGACAGGCAAGGCCTGG + Intergenic
1173252596 20:41372438-41372460 AAAGCAGCACATGCAGCTCTGGG + Intergenic
1174656435 20:52176031-52176053 CAATCAGCAAAGGCAGAGCTGGG - Intronic
1175285826 20:57836190-57836212 AGACCAGCAGAGGCAAGGCTGGG + Intergenic
1176290042 21:5038816-5038838 CAGGGAGCACTGGCAAAGCTTGG + Intronic
1176849543 21:13902233-13902255 AAAGATGCACAGGTACAGCTTGG - Intergenic
1177162138 21:17559381-17559403 AGACCAGCACAGGCAACGCAGGG - Intronic
1177949667 21:27518689-27518711 AAAGCAGCCCAGGCAAAAGATGG + Intergenic
1179867212 21:44224823-44224845 CAGGGAGCACTGGCAAAGCTTGG - Intronic
1180221000 21:46357862-46357884 AAAACAGCACAGGAAGAGCCTGG - Intronic
1180718650 22:17890280-17890302 AAAGCAGCACAGGGACAGCGCGG - Intronic
1181995340 22:26876220-26876242 AAAGGAGCACAGGGAAAATTTGG - Intergenic
1182916456 22:34037221-34037243 AAAGAAGAGCAGGCAAAGGTAGG + Intergenic
1183828390 22:40405507-40405529 AAAGCAGCCCAGGGAAGGCCTGG + Intronic
1184173186 22:42771518-42771540 AAAGCATCAGATGGAAAGCTTGG + Intergenic
1184359654 22:44007310-44007332 AAAGCAGCACGGGAAAGGATGGG - Intronic
1184374473 22:44103068-44103090 AAAGCAGCAAAGGCAGGGGTGGG - Intronic
1184648044 22:45906728-45906750 TAGGCAGCACAGTCAAAGCCCGG - Intergenic
949433927 3:4007756-4007778 CAAGCAGAACAGGCAGAGCTGGG + Intronic
949869530 3:8576284-8576306 AATACAGCACAGGCAACGCTTGG - Intergenic
950801494 3:15555265-15555287 GAAACAGCACAAGCAAAGCTGGG + Intergenic
950871382 3:16232644-16232666 AAAAGAGCAGAGGCAAAGGTGGG + Intergenic
952916262 3:38246210-38246232 AAAACAGCTCAGGTAAAGCCGGG + Exonic
953796124 3:45987248-45987270 AAAGGAGCACAGGAAAATATGGG + Intronic
954099224 3:48356529-48356551 AAAAGAGCACAGGTAAGGCTAGG - Intergenic
954349773 3:50033611-50033633 AAAGCTGCTCAGGCAAAACATGG - Intronic
957854943 3:85862783-85862805 AAAGCAGCAGAGGCAGTGATAGG + Intronic
958105898 3:89072641-89072663 AAATGAACAGAGGCAAAGCTAGG + Intergenic
958617010 3:96506923-96506945 GAGGCTGCTCAGGCAAAGCTTGG + Intergenic
961747331 3:129072933-129072955 AAAACAGCACCTGCACAGCTGGG - Intergenic
961782484 3:129328786-129328808 CAAGCAGCACAGTCAGACCTGGG + Intergenic
962075286 3:132075257-132075279 CATGAAGCACAGGCAAAGCAAGG + Intronic
962600911 3:136990267-136990289 CAGGCAGCACAAGCAAAGATAGG + Intronic
963066288 3:141266819-141266841 AAAGCAGCACAGAAAAAGGGAGG - Intronic
966550655 3:181200649-181200671 AAAGAAGAAGAGGGAAAGCTTGG - Intergenic
967318287 3:188171025-188171047 AAAGGAACACTGGCAAACCTGGG + Intronic
967573097 3:191054220-191054242 CACCCAGCACAGGAAAAGCTGGG - Intergenic
968686095 4:1959800-1959822 AAACCACCACAAGCAAACCTAGG - Intronic
972647706 4:40984687-40984709 AAAACTGCCCAGACAAAGCTGGG + Intronic
973367569 4:49219979-49220001 AAAGATGCACAGGTACAGCTTGG - Intergenic
973393484 4:49575453-49575475 AAAGATGCACAGGTACAGCTTGG + Intergenic
973594262 4:52470015-52470037 GAAGCAGCACAGCAAAGGCTTGG - Intergenic
975855306 4:78618089-78618111 AAAGCAGTGCAGGAAAAGCCGGG - Intergenic
976066877 4:81197936-81197958 AAAGCTGCTCAGCCAAGGCTAGG + Intronic
977692754 4:99933933-99933955 ATAGCACAACAGGCAAAACTGGG + Intronic
977910848 4:102534320-102534342 AAGGCAGCACAGAAAAGGCTGGG - Intronic
977913278 4:102562140-102562162 AAAACAGCACATGCAAAGAAAGG - Intronic
978901974 4:113962216-113962238 AAAGCAGCACAGGTGAATGTTGG - Intronic
979000523 4:115212062-115212084 AAAGCATTTCAGGCAATGCTAGG - Intergenic
980544510 4:134241280-134241302 AAAGCAGCATAGCAAAGGCTTGG + Intergenic
981965480 4:150595971-150595993 TTAGCAGCTCAAGCAAAGCTGGG - Intronic
1202766038 4_GL000008v2_random:149274-149296 AAAGATGCACAGGTACAGCTTGG - Intergenic
985686884 5:1286254-1286276 AGGCCAGCACAGGTAAAGCTGGG + Intronic
985729809 5:1540892-1540914 AAAGCCCCAGAGTCAAAGCTCGG + Intergenic
985995102 5:3593399-3593421 GAAGCGGCACTAGCAAAGCTGGG - Intergenic
986596838 5:9431401-9431423 AAAGCAGAAAAAGCAAAGGTTGG - Intronic
986893378 5:12335964-12335986 AAAGAAGAAAAGACAAAGCTAGG + Intergenic
991011624 5:61888540-61888562 ACTGCAGTAAAGGCAAAGCTGGG + Intergenic
992236764 5:74717789-74717811 AAAGCTGAACAGGCAAAGGCTGG - Intronic
992839527 5:80674190-80674212 AAAGCAGCAAAGGAAAAGCAGGG - Intronic
994813751 5:104557059-104557081 AAAGGAGCCAAGGTAAAGCTTGG - Intergenic
997386386 5:133476062-133476084 AAAGTAGCAGAGGCAAAGAAAGG + Intronic
999045470 5:148463957-148463979 AAAGAAGCACAGGCAATACAAGG + Intronic
999467774 5:151823435-151823457 GAAGCAACAGAGGCAAAGCAGGG - Intronic
999504434 5:152180213-152180235 AAAGCAGCCAAGGTACAGCTCGG - Intergenic
999586263 5:153092923-153092945 AAAGCAGCACGAGCAAAGGAGGG + Intergenic
1000635186 5:163636005-163636027 AAAGCAGTACATGCAAAACATGG - Intergenic
1000994622 5:167946260-167946282 AGAGCAGGACAGGACAAGCTGGG + Intronic
1002050009 5:176565357-176565379 GAAGCAGGACAGCCATAGCTGGG - Exonic
1003308890 6:4951820-4951842 AAATCAGCATATGCAAAGTTAGG - Intronic
1005443095 6:25892958-25892980 ATAGCAGCAAAGGCAAATATAGG + Intergenic
1005604999 6:27467691-27467713 AAAGCTGGAGAGGCACAGCTAGG + Intronic
1006739521 6:36297451-36297473 AAAGCAGCCCAGGGGAGGCTGGG - Intronic
1007474121 6:42107587-42107609 AAAGAAGGAGAGGCAAAGATGGG + Intronic
1009420729 6:63461345-63461367 AAAAGAGCACAGACAAGGCTGGG - Intergenic
1009525899 6:64745979-64746001 AATGCAGAACAGGCACTGCTGGG + Intronic
1011600992 6:89060353-89060375 AAAGCAGCACAGACCAAGAAGGG - Intergenic
1011772473 6:90690426-90690448 AAAGCAACACACGCAAAGGCAGG - Intergenic
1012653306 6:101784298-101784320 AAAGCAGCCAAGGTACAGCTCGG + Intronic
1014263534 6:119248673-119248695 AAAGCATCACAGGCGACGCCAGG + Intronic
1016886874 6:148967301-148967323 AAAGCAGCACAGCAGAAACTCGG + Intronic
1017467228 6:154705834-154705856 AAAGGCACACAGGCAAAGTTTGG - Intergenic
1017468140 6:154714060-154714082 AAAGCAGCACATGCATAGCATGG - Intergenic
1018711689 6:166501830-166501852 AAAGAAACAAAGGCAAGGCTTGG + Intronic
1019019403 6:168905059-168905081 GAAGCAGCAGAGTCAAGGCTGGG - Intergenic
1019024922 6:168951374-168951396 AGAGCAGCCCCGGCAAAGCAAGG + Intergenic
1019967346 7:4510589-4510611 AAAGCACTACAGTCAAAACTTGG - Intergenic
1021255701 7:18389835-18389857 AATGCAGCAAAGGCAAAGAGGGG + Intronic
1021457612 7:20846495-20846517 AAAACAGCACAGCCAAAGTTTGG - Intergenic
1021691727 7:23236716-23236738 AGAGCAGGACAGGCAAAGAGTGG - Intronic
1021835851 7:24673736-24673758 AAATCAGCAAAGGCAAAATTTGG - Intronic
1022020284 7:26393749-26393771 CCAGCAGCCCAGGCAAACCTGGG - Intergenic
1026393750 7:69929516-69929538 AAAGTAGCACAGGAAACTCTAGG - Intronic
1027201669 7:76067895-76067917 AATGCAGCGCAAGCGAAGCTGGG - Intergenic
1027832675 7:83199901-83199923 AAAGGAGCATAGGCAAGACTGGG + Intergenic
1028300297 7:89191049-89191071 AATGCAACACAGGCAGAACTCGG - Intronic
1029831915 7:103269309-103269331 CAAGGAGCACAGGGAAAGTTCGG + Intergenic
1030080536 7:105774081-105774103 AGAGCAGCTAAGGCAAAGGTTGG + Intronic
1032825786 7:135566521-135566543 AAAGCAGGAGAAGCAAAGCAGGG + Intronic
1033427227 7:141255203-141255225 AAGGCATCAGAGGCAGAGCTGGG + Intronic
1034997265 7:155585887-155585909 AAAGCAGCACATGTAAAACCTGG + Intergenic
1035185154 7:157120609-157120631 AAAGCATCACAGGCAAGGCAAGG + Intergenic
1035383955 7:158458164-158458186 AGCGGAGCACAGGCCAAGCTCGG - Intronic
1038762984 8:30401916-30401938 AAGTCAGCCCAGGCAAAGCCTGG + Intronic
1039329691 8:36523569-36523591 AAGGCAGCACATGCAAGGCAGGG + Intergenic
1039596357 8:38793339-38793361 AAAACAGGACAGGCAGGGCTTGG - Intronic
1039804818 8:40988799-40988821 AGAGCTGTACAGGCAGAGCTGGG + Intergenic
1040275679 8:46012511-46012533 AAAGCAGCTCAGCCAAGGATGGG - Intergenic
1042042483 8:64607537-64607559 CAAGCTGCTGAGGCAAAGCTGGG + Intronic
1042296848 8:67228814-67228836 AAAGAAGAATGGGCAAAGCTGGG - Intronic
1044227851 8:89739515-89739537 AATACAGCAAAGGCAATGCTAGG + Intergenic
1044282633 8:90374742-90374764 AAAGCGGCCAAGGCACAGCTCGG - Intergenic
1044569248 8:93699753-93699775 AAAGCAGCACACGCAAGGCCAGG + Intronic
1046213683 8:111114330-111114352 CAAGCAGGACAGGCTGAGCTGGG - Intergenic
1046974180 8:120255125-120255147 AAAGCTGCATAGTCAGAGCTGGG - Intronic
1048013242 8:130475360-130475382 AGAACAGCACCTGCAAAGCTGGG + Intergenic
1049400743 8:142425879-142425901 AAGGCAGCCCTGGGAAAGCTGGG - Intergenic
1049647650 8:143742834-143742856 ACAGCAGCACAGGCCATGTTTGG - Intergenic
1049649515 8:143758863-143758885 AAGGCAGCGCAGGGAAACCTTGG - Intergenic
1052877763 9:33580236-33580258 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052878205 9:33583327-33583349 AAAGACGCACAGGTACAGCTTGG + Intergenic
1052878649 9:33586423-33586445 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879080 9:33589508-33589530 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879514 9:33592624-33592646 AAAGATGCACAGGCACAGCTTGG + Intergenic
1053496464 9:38551608-38551630 AAAGATGCACAGGCACAGCTTGG - Intronic
1053496896 9:38554711-38554733 AAAGATGCACAGGTACAGCTTGG - Intronic
1053497328 9:38557786-38557808 AAAGATGCACAGGCACAGCTTGG - Intronic
1053497779 9:38560880-38560902 AAAGACGCACAGGTACAGCTTGG - Intronic
1053498222 9:38563969-38563991 AAAGATGCACAGGTACAGCTTGG - Intronic
1053540552 9:38969319-38969341 AAAGAAACACAGGCATACCTAGG + Intergenic
1053664346 9:40307136-40307158 AAAGATGCACAGGTACAGCTTGG + Intronic
1053664870 9:40310391-40310413 AAAGATGCACAGGTACAGCTTGG + Intronic
1053666183 9:40319516-40319538 AAAGATGCACAGGTACAGCTTGG + Intronic
1053804898 9:41791475-41791497 AAAGAAACACAGGCATACCTAGG + Intergenic
1053913418 9:42927604-42927626 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053913914 9:42930833-42930855 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053915327 9:42941466-42941488 AAAGATGCACAGGTACAGCTCGG + Intergenic
1054140386 9:61523982-61524004 AAAGAAACACAGGCATACCTAGG - Intergenic
1054377336 9:64459544-64459566 AAAGATGCACAGGTACAGCTTGG + Intergenic
1054518426 9:66056767-66056789 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054519744 9:66065893-66065915 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054520268 9:66069149-66069171 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054625590 9:67394604-67394626 AAAGAAACACAGGCATACCTAGG - Intergenic
1055199932 9:73647528-73647550 AAAGTAGCAAAAACAAAGCTGGG + Intergenic
1057161394 9:92890846-92890868 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057676805 9:97142268-97142290 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677244 9:97145365-97145387 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677687 9:97148453-97148475 AAAGATGCACAGGTACAGCTTGG - Intergenic
1058066783 9:100557347-100557369 AGAGCAGCACAGGGAAAGCCGGG - Intronic
1059712453 9:116881560-116881582 AAAGCACCACATGCATTGCTGGG + Intronic
1059982587 9:119789470-119789492 GAAGCAGCACATGCAAAGGTGGG - Intergenic
1059996434 9:119914740-119914762 AAAGCCACACAGGAAAAACTAGG + Intergenic
1060372670 9:123089172-123089194 AAAGCAGCACAGAAGAAGGTAGG + Intronic
1061615880 9:131778589-131778611 GGAGCAGCTCAGGGAAAGCTGGG - Intergenic
1203546787 Un_KI270743v1:134163-134185 AAAGATGCACAGGTACAGCTTGG - Intergenic
1185520123 X:732391-732413 AAAGCATCACAAGGAAAACTTGG - Intergenic
1187080764 X:15984644-15984666 AAAGAAGCAAAGACAAAGATAGG + Intergenic
1188720698 X:33519810-33519832 AAAGCAGTGGAGGCAAGGCTGGG - Intergenic
1189015566 X:37093155-37093177 AAGTCAGCCCAGGCAAAGCCTGG + Intergenic
1190306791 X:49087993-49088015 AAAGCATGAAAGGAAAAGCTGGG + Intronic
1192200318 X:69062376-69062398 AGAGTCCCACAGGCAAAGCTGGG - Intergenic
1192591042 X:72359642-72359664 AGAGCAGCAAATGCAAAGCTGGG + Intronic
1194499161 X:94658726-94658748 AAAGGGGCAAAGGTAAAGCTTGG + Intergenic
1194557782 X:95383276-95383298 AAAGCAGGACTGGCAGAGTTAGG + Intergenic
1195671697 X:107475364-107475386 ATAGCAGCTCAGGCTAAGGTTGG - Intergenic
1195770135 X:108342056-108342078 AAAGCAGCACTCCCAAGGCTAGG + Intronic
1196117297 X:112011530-112011552 AATTCAGCACAGCCAAAGCAAGG - Intronic
1196689585 X:118544959-118544981 AAAGCAACACAGGCCAGGCGTGG - Intronic
1197220245 X:123905298-123905320 ACAAGTGCACAGGCAAAGCTTGG - Intronic
1197997956 X:132400348-132400370 AAAGCAGCAAAGGGACTGCTAGG + Intronic
1200012333 X:153128094-153128116 GCAGCAGCACAGACGAAGCTCGG - Intergenic
1200027267 X:153271825-153271847 GCAGCAGCACAGACGAAGCTCGG + Intergenic
1200423126 Y:2993516-2993538 AAAGCAGTGCAGGTAAAGCAGGG + Intergenic
1200881439 Y:8216876-8216898 AAAGCACCATAGGCAAATCCAGG - Intergenic
1201969413 Y:19775015-19775037 AAGGCAGCACCAGCAAAGCATGG + Intergenic
1202105628 Y:21361344-21361366 AAAGCACCATAGGCAAATCCAGG - Intergenic