ID: 1171363033

View in Genome Browser
Species Human (GRCh38)
Location 20:24603587-24603609
Sequence ACGCCTGGGATGGCAGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171363033 Original CRISPR ACGCCTGGGATGGCAGCGGA GGG Intronic
903779902 1:25814485-25814507 AGTCCTGGGATGGAAGGGGAGGG + Intronic
904563575 1:31414005-31414027 GAGACTGGGATGGGAGCGGAGGG + Intronic
905553018 1:38859325-38859347 ACGCCCGGGAGGGCGGCGGCCGG - Intronic
920103503 1:203533752-203533774 ACCACTGGGCTGGTAGCGGATGG + Intergenic
922705478 1:227788207-227788229 AGGCGTGGGATGGGAGGGGAGGG + Intergenic
1064424904 10:15222040-15222062 AGGCCTGCGATGGCAGCTGTGGG + Intronic
1064622402 10:17229201-17229223 GCGGCTGGGATGGCAGTGGGAGG + Intronic
1065234133 10:23630305-23630327 ACATCTGGGATGGCAGAGGAAGG + Intergenic
1069601717 10:69712276-69712298 AGCCCTGGGAGGGCAGCGGAGGG + Intergenic
1070505792 10:77111597-77111619 AGGCCTGGGATGGCAGTGGTTGG - Intronic
1070700812 10:78600422-78600444 ATGCCTGGGGTGGCAGAGGAAGG - Intergenic
1072054461 10:91740620-91740642 ACACCTGTGCTGGCAGGGGAGGG + Intergenic
1072503543 10:96043099-96043121 GCCCCTGGGATGGAAGCGGTTGG + Intergenic
1073173438 10:101533486-101533508 ACTGCAGGGATGGCAGGGGAGGG - Intronic
1076095941 10:127735503-127735525 ACGACGGGGATGGAAGGGGAGGG + Intergenic
1077050679 11:565187-565209 ATGCATGGGAAGGCAGAGGATGG + Intergenic
1077278893 11:1733078-1733100 AAGCCTGGGCTGGAAGAGGATGG - Exonic
1078345107 11:10541016-10541038 AAGCCTGGCTCGGCAGCGGAGGG + Intronic
1081861629 11:46336312-46336334 ACACCTGGAAAGGCAGGGGAGGG + Intronic
1086499552 11:87437901-87437923 TCACCTGGGCTGGCAGTGGAAGG + Intergenic
1088671727 11:112147509-112147531 AGGCCTGGGATGGAAGGGTAGGG - Intronic
1090955774 11:131511912-131511934 ACACCTGGGATGGCAGGTGCAGG + Intronic
1096786133 12:54018256-54018278 CCGGCTGGGATGGCCGCGGCTGG - Intronic
1097248612 12:57620323-57620345 ATGCCTGGGATAGAAGTGGATGG - Exonic
1106464457 13:30000198-30000220 ACGTCTGGGAAGGCAGCAGACGG + Intergenic
1106735717 13:32586479-32586501 ACGGCAGGGCTGGCTGCGGAAGG + Exonic
1107151872 13:37121128-37121150 TGGCCTGAGATGGCAGAGGAGGG - Intergenic
1110920857 13:81083023-81083045 ACTCTTGGGATTGCAGCAGAAGG - Intergenic
1113364491 13:109663559-109663581 CCTCCTGGGTTGGCAGCTGATGG - Intergenic
1115987300 14:39115278-39115300 ACGCTTTGGGTGGCAGAGGAGGG - Intronic
1118003727 14:61546568-61546590 ACACCTGGCATGGCAGTGGGAGG + Intronic
1123025733 14:105422868-105422890 GTGCCTGTGAGGGCAGCGGATGG + Intronic
1125662111 15:41402514-41402536 ACGCCTTGTTTGGCATCGGAAGG - Intronic
1129524237 15:76203997-76204019 GCTGCTGGGATGGCAGCGGCGGG - Exonic
1129892562 15:79081288-79081310 ACGGCTGGGATGGGAGTGGAGGG + Intronic
1131438811 15:92443309-92443331 AGGACTGGGATGGCAGCAGAGGG - Intronic
1131973691 15:97919428-97919450 ACACCTGGAATGGCAGCAGTTGG - Intergenic
1132525204 16:410835-410857 CCTCCTGGGATGGAAGCAGACGG - Intronic
1132853724 16:2035707-2035729 GGGCCTGGGATGGTAGCGGGGGG + Intronic
1132904129 16:2273537-2273559 AAACCTGTGATGGCAGTGGAGGG + Intergenic
1133331021 16:4974067-4974089 AGGACTGGGGTGGCAGGGGAGGG + Intronic
1137629747 16:49934628-49934650 ACGCCTTGGATGGCACCTAAGGG - Intergenic
1138439161 16:57024022-57024044 AGGCCTGGGCTGGCAGCGAAGGG + Intronic
1147438379 17:40431762-40431784 TCCTCTGGGATGGCAGTGGAGGG - Intergenic
1147906987 17:43829966-43829988 TCTCCTGGGATGGGGGCGGAGGG - Intronic
1148581182 17:48745063-48745085 ACCCCTGGGTTGGAAGTGGAAGG + Intergenic
1148835636 17:50464331-50464353 AGGCCTGGGATGACAGCAGATGG + Intronic
1148853008 17:50563772-50563794 AAGCCTGGGTTGGCTGAGGATGG + Intronic
1149667954 17:58379196-58379218 ATGCCTGGGATCACAGTGGAAGG + Intronic
1150623848 17:66828951-66828973 CAGCCTGGGATGGCAGCTGGTGG + Intergenic
1151836486 17:76585831-76585853 CTGCCTGGGACGTCAGCGGACGG - Exonic
1151876070 17:76868856-76868878 AGGCCTGGGCGTGCAGCGGAGGG - Intronic
1152682154 17:81674080-81674102 AGGGCTGGGACGGCAGCGGGTGG + Intergenic
1152736472 17:81999817-81999839 ACACCTGGGAGGGCAGAGGCCGG + Intronic
1157491080 18:48124252-48124274 AAGCCTGGGATGGCAGGCGGTGG + Intronic
1160448773 18:78947577-78947599 ACGCCTGAGCTGACAGTGGAGGG + Intergenic
1162369479 19:10270304-10270326 GAGCCTGGGACGCCAGCGGAGGG + Intergenic
1162959442 19:14117448-14117470 AGGCCAGGGCTGGCAGCGCAGGG + Intronic
1163672796 19:18638311-18638333 ACGCATGGGATGGGTGGGGAAGG + Intronic
1164580905 19:29434258-29434280 GAGCCTGGTATGGCAGAGGACGG - Intergenic
1164972923 19:32547830-32547852 GCGTATGGGATGGCAGTGGAAGG - Intergenic
1165245054 19:34493921-34493943 AGGCCTGGCCTGGCAGGGGATGG - Intronic
1166686009 19:44796725-44796747 AATCCTGGGGTGGCAGCGTAGGG - Intronic
927637701 2:24828100-24828122 ACGGCAGGGATGGAAACGGAGGG - Exonic
927857826 2:26538231-26538253 ACCCCTGGGGTGGCTGCAGAAGG - Intronic
927926249 2:27015823-27015845 TCGCCTGGGAAGGAAGCAGATGG + Intronic
928244349 2:29614434-29614456 AAGCCTGGGAGGGCAGGGGCTGG - Intronic
933893473 2:86790743-86790765 ACGCCCGGGAAGGCAGGGGATGG - Intronic
934735815 2:96689326-96689348 ACCCCTGGGATGGCACTGGCAGG + Intergenic
937319579 2:120953020-120953042 ACACCTAGTATGGCAGCTGAGGG + Intronic
942231454 2:173864216-173864238 ACCCCTGTGATGGGATCGGAGGG - Intergenic
947611075 2:231525467-231525489 AAGCCCGGGAAGGCAGCTGAGGG - Intronic
1168804003 20:662324-662346 CCGCCTGGAGTGGCAGGGGAAGG + Exonic
1168828615 20:831695-831717 ACCCCTGGGTGGGCAGGGGAGGG - Intergenic
1171363033 20:24603587-24603609 ACGCCTGGGATGGCAGCGGAGGG + Intronic
1175888574 20:62305966-62305988 ACACCCGGGATTGCGGCGGATGG + Intronic
1175988072 20:62774067-62774089 AGGCCGGGGAGGGCAGCGGGTGG - Intergenic
1179712923 21:43273456-43273478 AAGCCTGGGTTGCCAGCGGCCGG - Intergenic
1181531285 22:23518944-23518966 AAGCCTGGGACGGGAGCGGGGGG + Intergenic
1181908890 22:26222073-26222095 TCGCCTGGGGTGGCAGTGGGTGG + Intronic
1183369346 22:37423737-37423759 ATGCCTGGGGTGCCAGAGGAAGG - Intronic
1184363005 22:44030187-44030209 ACGCCTGGGCTGGGAGCTGGGGG + Intronic
1184866174 22:47202858-47202880 AGGCCTGTGATGGCAGTGGTGGG - Intergenic
1184987500 22:48145674-48145696 GGGCCTGGGGTGGCAGAGGAGGG - Intergenic
950121051 3:10482812-10482834 AGGCCTGGGATGGCAGACGGAGG - Intronic
950702721 3:14761321-14761343 AGGCCTGGGGTGGCTGGGGAAGG - Intronic
952428741 3:33201689-33201711 AGGCCTGAGATGGCTGCAGAGGG - Intronic
952860829 3:37810992-37811014 ATGCCTGAGATGCCAGCAGATGG - Intronic
953611654 3:44451803-44451825 AGGCCTGGGGTGGGAGCTGAGGG - Intronic
953879432 3:46683956-46683978 AGGCCTGGGGTGTCAGCCGAGGG + Intronic
954031854 3:47825289-47825311 ACTCCTGGGATGGCAGAGCTAGG + Intronic
954856396 3:53647427-53647449 AAGACTGGGATGGCAGAAGAAGG - Intronic
956165641 3:66396346-66396368 AGCCCTGGGATGGCAGCAGAAGG - Intronic
960964808 3:123097331-123097353 TGGGCTGGGAGGGCAGCGGAGGG + Intronic
961667772 3:128504327-128504349 AGGCCTGGGATGTTAGAGGAGGG + Intergenic
961796308 3:129411459-129411481 ACGTGTGGGAAGGGAGCGGAGGG - Intronic
962429219 3:135304003-135304025 AGGCCAGGGAGGGCAGAGGAGGG - Intergenic
968199452 3:196739946-196739968 ACGCCAGGGAGGGGAGGGGAGGG - Exonic
968816788 4:2825741-2825763 AGGCCTGGCATGGCAGCAGCTGG + Intronic
969120894 4:4910333-4910355 AGGCCTGTGGTGGCAGGGGATGG - Intergenic
969448625 4:7260045-7260067 AAGCCTGGGAGGGCAGGAGAGGG - Intronic
971287341 4:25303373-25303395 ACGCCTGCCATGGAGGCGGAGGG - Intergenic
973781794 4:54294794-54294816 AGGCCTGGGAAGGCAGAGCAGGG - Intronic
981713514 4:147731871-147731893 ACGCCTCGGAAGGAAGAGGAGGG + Intergenic
985937174 5:3106342-3106364 GCCCCTGGGATGGAAGGGGAAGG + Intergenic
988093239 5:26569256-26569278 ACGCCATGGATGGCAGTGGGAGG - Intergenic
996397556 5:123028412-123028434 TCCCCTGGGATGGCAGCGTGCGG - Intronic
998007217 5:138665082-138665104 TCGGCTGAGATGGCAGCAGAAGG + Intronic
998256334 5:140591564-140591586 TCCCCTGGGATGGCAGTGGGTGG + Intronic
998399986 5:141843596-141843618 AGACCTGGGATGGAAGCAGATGG - Intergenic
998590409 5:143471993-143472015 ATTCCTGGGATGGCAGAGTAGGG + Intergenic
1001407279 5:171484935-171484957 ATGGCTGGGATGGGAGCTGAAGG + Intergenic
1003425286 6:5994808-5994830 ACGTCTGGGAGGGGAGCGGGGGG + Intergenic
1010125892 6:72431508-72431530 AGGACTGGGATGGCAGCTTAGGG - Intergenic
1011492677 6:87908508-87908530 ATGACTGGGTTGGCAGAGGAGGG + Intergenic
1026805861 7:73429413-73429435 GCGCCTGGGAAGCCAGAGGAGGG - Intergenic
1035879899 8:3234653-3234675 AAGCCTGGGAGAGCAGAGGAAGG + Intronic
1035936702 8:3849366-3849388 GCGCCTGTGATGGCAGCTGCGGG - Intronic
1036151676 8:6304951-6304973 ACCAGTGGGATGGCAGAGGATGG + Intergenic
1037617631 8:20533913-20533935 AGCCATGGGATGGCAGAGGATGG + Intergenic
1038509418 8:28116927-28116949 GCGACGGGGATGGCAGCAGAAGG + Intronic
1039896277 8:41719008-41719030 CCTCCAGGGATGGCAGAGGATGG - Intronic
1040067743 8:43161905-43161927 ATGCCTGGGCTGGCAGAGGTTGG - Intronic
1040122698 8:43700378-43700400 AAGCCTGTGATGGCACTGGAGGG - Intergenic
1044725461 8:95191036-95191058 AGGACTGGGATGTCAGCAGATGG + Intergenic
1044758791 8:95494741-95494763 AGGCCTGGGATGGCTGCGGGAGG + Intergenic
1045712087 8:104996577-104996599 ATCCCTGGGAGGGCACCGGAGGG - Intronic
1047381753 8:124371692-124371714 ACGCCTGGGACGGCTGGGGGCGG - Intronic
1048984977 8:139730446-139730468 AGGCCTGGGCTGGCAGCCCAGGG - Exonic
1049060621 8:140273561-140273583 AGGCCTGGGGTGGGAGGGGAAGG - Intronic
1049766027 8:144355609-144355631 ACCCCGGGGAAGGCAGCGGCAGG + Exonic
1050155960 9:2666741-2666763 GGGCCTGTGATGGCAGCGGCCGG - Intergenic
1051936345 9:22447146-22447168 ACGCCGGGGACGGGGGCGGAGGG - Exonic
1057298140 9:93861124-93861146 AGGCCTGAGAGGGCAGCGGTCGG + Intergenic
1058096143 9:100862482-100862504 CCTCCTGGGAAGGCAGTGGAGGG - Intergenic
1058938482 9:109791440-109791462 CAGCCTGGCATGGCAGTGGAGGG + Intronic
1203774097 EBV:63158-63180 TCGCCGGGGGTGGCAGTGGAGGG + Intergenic
1186898611 X:14030049-14030071 AGGCGTGGGATGGCTGCGGGTGG + Intergenic
1192203577 X:69082175-69082197 AGACCTGGGAGGGCAGGGGAAGG - Intergenic
1192227093 X:69236930-69236952 CCCCCTTGGATGGCAGGGGAAGG - Intergenic
1199770539 X:150972601-150972623 AAGGCTGGGATGTCAGGGGAGGG - Intergenic