ID: 1171363107

View in Genome Browser
Species Human (GRCh38)
Location 20:24604281-24604303
Sequence AGGTAACGCTGAGACCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 764
Summary {0: 1, 1: 0, 2: 0, 3: 102, 4: 661}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171363099_1171363107 11 Left 1171363099 20:24604247-24604269 CCAGAGTGACTCCATCTTGAACA 0: 12
1: 179
2: 341
3: 847
4: 1024
Right 1171363107 20:24604281-24604303 AGGTAACGCTGAGACCTGCTGGG 0: 1
1: 0
2: 0
3: 102
4: 661
1171363104_1171363107 0 Left 1171363104 20:24604258-24604280 CCATCTTGAACAGGGGCTGGTTA 0: 2
1: 38
2: 469
3: 885
4: 804
Right 1171363107 20:24604281-24604303 AGGTAACGCTGAGACCTGCTGGG 0: 1
1: 0
2: 0
3: 102
4: 661

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171363107 Original CRISPR AGGTAACGCTGAGACCTGCT GGG Intronic
900878773 1:5365654-5365676 AAATAAGGCTGAGACCTACTAGG - Intergenic
901232663 1:7649850-7649872 AGCTGATGCTGAGCCCTGCTAGG + Intronic
901290839 1:8123098-8123120 AAATAAGGCTGAGACCTACTGGG - Intergenic
901314489 1:8296843-8296865 AAATAAGGCTGAGACCTACTGGG - Intergenic
901410309 1:9078380-9078402 AAGTGAGGCTGAGACCTACTGGG - Intronic
901573383 1:10180091-10180113 AGCAAACGCTGAGACCTGAAAGG + Exonic
902193179 1:14778117-14778139 AAATAAGGCTGAGACCTACTGGG - Intronic
902237847 1:15068996-15069018 TGGTCAGGCTGAGAACTGCTGGG - Intronic
902543138 1:17168362-17168384 AGGTAACTCACAGCCCTGCTGGG - Intergenic
902567331 1:17320835-17320857 AAATAAGGCTGAGATCTGCTGGG - Intronic
903206477 1:21786059-21786081 AAATAAGGCTGAGACCTACTGGG - Intergenic
903618282 1:24678627-24678649 AAATAAGGCTGAGACCTGCTGGG + Intergenic
903899846 1:26635956-26635978 AAATAAGGCTGAGACCTACTAGG + Intergenic
904059365 1:27695981-27696003 AAATGAGGCTGAGACCTGCTGGG - Intergenic
904489112 1:30847444-30847466 AGGCAACTCTCAGACCTGCTGGG - Intergenic
904583199 1:31563166-31563188 AGATAAGGCTGAGACCTACTGGG - Intergenic
904587977 1:31590631-31590653 AAATAAGGCTGAGACCTACTGGG - Intergenic
905428472 1:37903118-37903140 AAATAAGGCTAAGACCTGCTGGG + Intronic
905428917 1:37907531-37907553 AAATAAGGCTAAGACCTGCTGGG + Intronic
906086145 1:43136285-43136307 AAATAAGGCTGAGACCTGCTGGG - Intergenic
906473248 1:46148907-46148929 AAATTAGGCTGAGACCTGCTGGG + Intronic
906859174 1:49340723-49340745 AAATGAGGCTGAGACCTGCTGGG + Intronic
907284384 1:53370723-53370745 AGGTAAAGCTGACTGCTGCTGGG - Intergenic
907542961 1:55233274-55233296 AAATAAGGCTGAGACCTACTGGG - Intergenic
908748739 1:67399810-67399832 ACATAAGGCTGAGACCTACTGGG + Intergenic
909014395 1:70367470-70367492 AACTAAGGCTGAGACCTACTAGG - Intronic
910051373 1:82978045-82978067 AAATAAGGCTGAGACCTACTGGG - Intergenic
911153453 1:94617525-94617547 AAATAAGGCTGAGACCTACTGGG + Intergenic
911189226 1:94931461-94931483 AAATAAGGCTGAGACCTGCTAGG + Intergenic
911576754 1:99587188-99587210 AAATAAGGCTGAGACCTACTGGG - Intergenic
912159852 1:106968379-106968401 AGGGAACTCTGAGACTTTCTAGG + Intergenic
912388778 1:109287061-109287083 AAATAAGGCTGAGACCTACTGGG - Intergenic
913097343 1:115531509-115531531 AAATGAGGCTGAGACCTGCTGGG + Intergenic
913134484 1:115874662-115874684 AAATAAGGCTGAGACCTGCTGGG - Intergenic
913484926 1:119325714-119325736 AAATGAGGCTGAGACCTGCTGGG + Intergenic
913669293 1:121080668-121080690 AAATAAGGCTGAGACCTACTGGG - Intergenic
914021046 1:143868065-143868087 AAATAAGGCTGAGACCTACTGGG - Intergenic
914442522 1:147719862-147719884 AAATAAGGCTGAGACCTACTGGG + Intergenic
914659537 1:149775992-149776014 AAATAAGGCTGAGACCTACTGGG - Intergenic
914817789 1:151075783-151075805 AAATAAGGCTGAGACCTACTGGG - Intronic
915219000 1:154358945-154358967 ACATAAGGCTGAGACCTACTGGG + Intergenic
916810805 1:168304052-168304074 AAGTGAGGCTGAGACCTACTGGG - Intronic
918347845 1:183621941-183621963 AAATAAGGCTGAGACCTACTGGG - Intergenic
918949223 1:191114044-191114066 AAATAAGGCTGAGACTTGCTGGG + Intergenic
919323968 1:196081979-196082001 AAATAAGGCTGAGACCTACTGGG + Intergenic
919337527 1:196256819-196256841 AAATAAGGCTGAGACCCGCTGGG + Intronic
919827485 1:201513707-201513729 AAATAAGGCTGAGACCTACTGGG - Intergenic
919966533 1:202532403-202532425 AAATAAGGCTGAGACCTACTGGG - Intronic
920113012 1:203600382-203600404 AAATAAGGCTGAGACCTACTGGG - Intergenic
920137130 1:203779065-203779087 AAATGAGGCTGAGACCTGCTGGG + Intergenic
920824206 1:209410021-209410043 AAATAAGGCTGAGACCTACTGGG + Intergenic
921053159 1:211525344-211525366 AAATAAGGCTGAGGCCTGCTGGG + Intergenic
921294248 1:213687207-213687229 AAATGAGGCTGAGACCTGCTGGG - Intergenic
921474009 1:215583598-215583620 AAATAAGGCTGAGACCTGCTGGG - Intronic
921831272 1:219730482-219730504 AAATAAGGCTGAGACCTACTGGG + Intronic
922364250 1:224849297-224849319 AAATAAGGCTGAGACCTACTGGG + Intergenic
922811551 1:228417969-228417991 AAATAATTCTGAGACCTGCTGGG - Intergenic
922815036 1:228442751-228442773 AAATAAGGCTGAGACCTGCTGGG + Intergenic
923413754 1:233734627-233734649 AAATAAGGCTGAGACCTACTGGG + Intergenic
924050471 1:240075367-240075389 AAGTGAGGCTGAGACCTGCCGGG - Intronic
924174791 1:241379639-241379661 AAATAAGGCTGAGACCTACTGGG + Intergenic
924204381 1:241696885-241696907 AAATAAGGCTGAGTCCTGCTGGG - Intronic
1062771820 10:107208-107230 AAATAAGGCTGAGACCTACTGGG - Intergenic
1063028221 10:2204333-2204355 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1063212184 10:3890881-3890903 AAATAAGGCTGAGACCTACTGGG + Intergenic
1063518480 10:6719907-6719929 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1064075510 10:12265520-12265542 AAATAAGGCTGAGACCTACTGGG - Intergenic
1064098694 10:12444248-12444270 AAATAAGGCTGAGACCTACTGGG - Intronic
1064160453 10:12941015-12941037 ATATAAGGCTGAGACCTACTGGG + Intronic
1064232099 10:13538093-13538115 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1064373990 10:14779159-14779181 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1064570321 10:16685769-16685791 AAATGAGGCTGAGACCTGCTGGG - Intronic
1064745840 10:18477389-18477411 AAATAAGGCTGAGACCTACTGGG - Intronic
1064757120 10:18581207-18581229 AAATAAGGCTGAGACCTACTGGG + Intronic
1065383149 10:25110017-25110039 AAATAAGGCTGAGACCTGCTGGG - Intergenic
1065924720 10:30425462-30425484 AAATAAGGCTGAGACCTACTGGG - Intergenic
1066033935 10:31461206-31461228 AGGGAATGCTAAGAACTGCTGGG + Exonic
1066191112 10:33057066-33057088 AAATAAGGCTGAGACCTACTGGG + Intergenic
1066268466 10:33798923-33798945 AAATAAGGCTGAGACCTACTGGG - Intergenic
1066386217 10:34943624-34943646 AAATAAGGCTGAGACCTACTGGG + Intergenic
1066388365 10:34959534-34959556 AGGTAACACAGACCCCTGCTGGG + Intergenic
1066640504 10:37550273-37550295 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1066977187 10:42379701-42379723 AAATAAGGCTGAGACCTTCTGGG - Intergenic
1067341733 10:45411355-45411377 AAATAAGGCTGAGACCTACTGGG - Intronic
1067823331 10:49550097-49550119 AAATAAGGCTGAGACCTACTGGG - Intergenic
1068730099 10:60348258-60348280 AGGTGACACAGAAACCTGCTGGG + Intronic
1069329674 10:67277542-67277564 AAATAAGGCTGAGACCTACTAGG + Intronic
1069405503 10:68094233-68094255 AAATAAGGCCGAGACCTGCTGGG - Intergenic
1070252188 10:74782653-74782675 AAATAAGGCTGAGACTTGCTGGG + Intergenic
1070575951 10:77679078-77679100 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1071675392 10:87651070-87651092 AAAGAAGGCTGAGACCTGCTAGG + Intergenic
1071829263 10:89355575-89355597 AAATAAGGCTGAGACCTACTGGG + Intronic
1072579784 10:96730742-96730764 AAATAAGGCTGAGACCTACTGGG + Intergenic
1074299308 10:112219053-112219075 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1075022561 10:118962411-118962433 AAATATGGCTGAGACCTGCTGGG + Intergenic
1075124435 10:119688343-119688365 AAATAAGGCTGAGACCTGCTGGG - Intergenic
1075602780 10:123782784-123782806 AAATGAGGCTGAGACCTGCTGGG + Intronic
1076991376 11:277918-277940 AAATAAGGCTGAGACCTACTGGG - Intergenic
1077005324 11:352519-352541 AGATGAGGCTGAGACTTGCTGGG - Intergenic
1077873560 11:6283698-6283720 AAATAAGGCTGGGACCTGCTAGG + Intergenic
1077874016 11:6288255-6288277 AAATAAGGCTGAGACCTGCTAGG + Intergenic
1078130535 11:8610584-8610606 AGGTAACACTGAGACTTCCAAGG + Intergenic
1078704948 11:13734406-13734428 AAATAAGGCTGAGACCTGCTGGG - Intergenic
1079235028 11:18682077-18682099 AAATAAAGCTGAGACCTACTGGG + Intergenic
1079236099 11:18691657-18691679 AAATAAGGCTGAGACCTACTGGG + Intergenic
1079281223 11:19088922-19088944 AAATAAGGCTGAGACCTACTGGG - Intergenic
1079947956 11:26766997-26767019 AAATAAGGCTGAGACCTACTGGG + Intergenic
1080288091 11:30640006-30640028 AAATAAGGCTGAGACCTACTGGG + Intergenic
1081530176 11:43953113-43953135 AAATAAGGCTGAGACCTACTGGG + Intergenic
1083349058 11:62014112-62014134 AAATAAGGCTGAGACCTACTGGG + Intergenic
1083391011 11:62350106-62350128 AAATAAGGCTGAAACCTGCTGGG - Intronic
1083483524 11:62966050-62966072 AAATAAGGCTGAGACCTACTGGG - Intronic
1083604190 11:63967789-63967811 AAATAAAGCTGAGACCTGCCAGG - Intergenic
1084053609 11:66617056-66617078 AGGTAACGCGGAGGCGCGCTCGG + Exonic
1086453225 11:86937416-86937438 AAATAAGGCTGAGACCTACTGGG + Intronic
1086466218 11:87056283-87056305 AAATGAGGCTGAGACCTGCTGGG - Intronic
1086508108 11:87527307-87527329 AAATAAGGCTGAGACCTACTGGG + Intergenic
1086541246 11:87915247-87915269 AAATAAGGCTGAGACCTACTGGG + Intergenic
1086572780 11:88304576-88304598 AGATGAGGCTGAGACCTACTGGG + Intronic
1087119446 11:94558414-94558436 AAATAAGCCTGAGACCTGCTGGG + Intronic
1087251404 11:95904426-95904448 AAATAAGGCTGAAACCTGCTGGG + Intronic
1087304676 11:96474454-96474476 AAGTAAGGCTAAGACCTGCTGGG + Intronic
1087992982 11:104769098-104769120 ACATAATGCTGAGACCTACTGGG - Intergenic
1088317075 11:108518700-108518722 AAATAAGGCTGAGACCTACTGGG + Intronic
1088481418 11:110299246-110299268 AAATAAGGCTTAGACCTGCTGGG + Intergenic
1088581343 11:111319826-111319848 AAATAAGGCTGAGACCTACTGGG + Intergenic
1088998966 11:115032937-115032959 AAATAAGGCTGAGACCTACTGGG + Intergenic
1089579346 11:119471638-119471660 CGAGAACCCTGAGACCTGCTGGG - Intergenic
1089579352 11:119471667-119471689 CGAGAACCCTGAGACCTGCTGGG - Intergenic
1091458808 12:628592-628614 AAATGAGGCTGAGACCTGCTAGG + Intronic
1092782017 12:11996163-11996185 AAATAAGGCTGAGACCTCCTGGG - Intergenic
1093139355 12:15489703-15489725 AAATAAGGCTGAGACCTACTGGG - Intronic
1093421573 12:18980172-18980194 AAATAAGGCTGAGACCTACTGGG - Intergenic
1093924172 12:24892128-24892150 AAATAAGGCTGAGACCTACTGGG - Intronic
1094594464 12:31852065-31852087 AAATAAGGCTGAGACCTACTGGG + Intergenic
1094614167 12:32021457-32021479 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1095157624 12:38877841-38877863 AAATAAGGCTGAGACCTGCTAGG + Intronic
1095158976 12:38893217-38893239 AAATAAGGCTGAGACCTGCTGGG + Intronic
1095178841 12:39123747-39123769 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1095479592 12:42621426-42621448 AAGTAAAGCTAAGACATGCTGGG - Intergenic
1095904690 12:47365892-47365914 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1097338630 12:58412851-58412873 AAACAAGGCTGAGACCTGCTGGG - Intergenic
1097845432 12:64361343-64361365 AAATGAGGCTGAGACCTGCTGGG + Intronic
1097964235 12:65562051-65562073 AAATAAGGCTGAGACCTACTGGG + Intergenic
1098316045 12:69194261-69194283 AAATAAGGCTGAGACCTACTGGG + Intergenic
1098921262 12:76304293-76304315 AAATAAGGCTGAGACCTACTGGG - Intergenic
1099008958 12:77268469-77268491 AAATAAGGCTGAGAACTGCTGGG - Intergenic
1100426819 12:94495216-94495238 AAATAAGGCTGAGACCTACTGGG + Intergenic
1100448680 12:94684649-94684671 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1100516337 12:95331731-95331753 AAATAAAGCTGAGACCTCCTGGG + Intergenic
1100597366 12:96083187-96083209 AAATAAGGCTGAGACCTACTGGG + Intergenic
1101620463 12:106382164-106382186 AAATAAGGCTGAGACCTACTGGG - Intronic
1101694304 12:107109938-107109960 AAATAAGGCTGAGACCTACTGGG + Intergenic
1101855537 12:108439780-108439802 AAATAAGGCTGAGACCTACTGGG + Intergenic
1102326481 12:111989402-111989424 AGGTTAGGCTGAGACTTGTTTGG - Intronic
1102389993 12:112541876-112541898 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1102410765 12:112716253-112716275 ACATAAGGCTGAGACCTACTGGG - Intronic
1102526148 12:113513803-113513825 AAATAAGGCTGAGACCTACTGGG + Intergenic
1103132192 12:118479077-118479099 AAATAAGGCTAAGACCTGCTGGG - Intergenic
1103144508 12:118583010-118583032 AAATGACGCTGAGATCTGCTGGG - Intergenic
1103613145 12:122136076-122136098 CTGTAGTGCTGAGACCTGCTGGG - Intronic
1103981175 12:124737964-124737986 TGGCAAGGCTGAGGCCTGCTTGG - Intergenic
1104233238 12:126905591-126905613 AAATAAGGCTGAGACCTACTGGG - Intergenic
1104464436 12:128979076-128979098 AACTGAGGCTGAGACCTGCTGGG - Intronic
1104640476 12:130463742-130463764 AGATGAGGCTGAGACCTACTGGG + Intronic
1104671481 12:130683520-130683542 AGATGAGGCTGAGACCTACTGGG + Intronic
1104800678 12:131553605-131553627 AAATAAGGCTGAGTCCTGCTGGG - Intergenic
1104808579 12:131605564-131605586 AGATCAGGCTGAGACCTACTGGG - Intergenic
1105053820 12:133079515-133079537 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1106590954 13:31098173-31098195 AAGTAAGGCTGAGACCTACTGGG + Intergenic
1106920830 13:34561640-34561662 AGGCACTGCTGAGACATGCTTGG - Intergenic
1107020078 13:35742256-35742278 GGTTAAGGCTGAGACCTACTGGG - Intergenic
1107540917 13:41388349-41388371 AAATAAAGCTGAGACCTGCTGGG - Intergenic
1108459361 13:50649717-50649739 AAATAAGGCTGAGACCTACTGGG - Intronic
1108508244 13:51132754-51132776 AAATGACGCTGAGACCTGCTGGG + Intergenic
1108509185 13:51139485-51139507 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1108694109 13:52887623-52887645 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1109934131 13:69259098-69259120 AAATAAGGCTGAGACCTACTGGG + Intergenic
1112018646 13:95352527-95352549 AAGTAAGGCTGACACCTACTGGG - Intergenic
1112255473 13:97826621-97826643 AAATAAGGCTGAGACCTACTGGG + Intergenic
1112720209 13:102235795-102235817 AAATGAGGCTGAGACCTGCTGGG + Intronic
1112903824 13:104392371-104392393 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1112934620 13:104782326-104782348 AAGTAAGGCTGAGACCTACTGGG - Intergenic
1113711409 13:112467539-112467561 AGGTGGGGCTGCGACCTGCTTGG - Intergenic
1114430313 14:22655165-22655187 AAATAAGGCTGAGATCTGCTGGG + Intergenic
1114790310 14:25650453-25650475 AAATAAGGCTGAGACCTGCTGGG - Intergenic
1115701559 14:35958505-35958527 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1116345736 14:43790906-43790928 AAATAAGGCTGAGACCTACTGGG - Intergenic
1116787870 14:49307976-49307998 AAATAAGGCTGAGACCTACTGGG - Intergenic
1116897682 14:50333180-50333202 AAATAAGGCTGAGACCTACTGGG + Exonic
1116957322 14:50938027-50938049 AAATAAGGCTGAGACCTACTGGG + Intronic
1117515862 14:56500519-56500541 AAATAAGGCTGAGACCTACTGGG - Intronic
1118175583 14:63436902-63436924 AAATAAGGCTGAGACCTGCTGGG + Intronic
1118578478 14:67268834-67268856 AAATAAGGCTGAGACCTACTGGG - Intronic
1118949305 14:70419468-70419490 AAATAAGGCTGAGACCTACTGGG + Intergenic
1118998072 14:70855498-70855520 AAATAAGGCTGAGACCTACTGGG + Intergenic
1119022991 14:71130724-71130746 AAATAAGGCTGAGACCTACTGGG + Intergenic
1119034719 14:71219846-71219868 AAATAAGGCTGAGACCTACTGGG - Intergenic
1120061293 14:79985959-79985981 AAATAAGGCTGAGACCTACTGGG - Intergenic
1120361268 14:83505623-83505645 AAATAAGGCTGAGACCTACTGGG - Intergenic
1120895267 14:89525136-89525158 AAATAAGGCTGAGACCTACTGGG + Intronic
1121004084 14:90476788-90476810 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1121462216 14:94089656-94089678 AAATAAGGCTGAGACCTACTAGG - Intronic
1121666889 14:95679344-95679366 AAATAAGGCTGAGACCTACTGGG + Intergenic
1121673541 14:95732726-95732748 AAATAAGGCTGAGACCTACTGGG - Intergenic
1122174433 14:99906671-99906693 AAATAAGGCTGAGACCTACTGGG - Intronic
1123150327 14:106175265-106175287 AGGTCCCTCTGAGATCTGCTGGG + Intergenic
1123156645 14:106233672-106233694 AAATAAGACTGAGACCTGCTGGG - Intergenic
1123187650 14:106535838-106535860 AAATAAGACTGAGACCTGCTGGG - Intergenic
1123207417 14:106726774-106726796 AAATAAGACTGAGACCTGCTGGG - Intergenic
1123212444 14:106773768-106773790 AAATAAGACTGAGACCTGCTGGG - Intergenic
1123891318 15:24783097-24783119 AAGTAGTGCTGAGACCAGCTCGG + Intergenic
1124054922 15:26233495-26233517 AGGTTACGATGAGCCCTGATTGG - Intergenic
1124181865 15:27483630-27483652 GGGGAACGCTGACACCTGCAAGG - Intronic
1124387426 15:29222053-29222075 AAATAAGGCTGAGACCTACTGGG + Intronic
1124438931 15:29673351-29673373 AAATAAGGCTGAGACCTGCTGGG - Intergenic
1124824856 15:33083716-33083738 AAATAAGGCTGAGACCTGCTGGG + Intronic
1125072698 15:35574485-35574507 AGGGAAGGCAGAGACCTCCTGGG - Intergenic
1125675246 15:41498720-41498742 GGGGAACACTGAGACCTGCCTGG - Intronic
1126157853 15:45582121-45582143 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1126172833 15:45708511-45708533 AAATAAGGCTGAGACCTACTGGG - Intergenic
1126624184 15:50670300-50670322 AAATAAGGCTGAGACCTGCTGGG + Intronic
1127151698 15:56082462-56082484 AAATGAAGCTGAGACCTGCTGGG - Intergenic
1127522856 15:59760380-59760402 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1127549345 15:60021931-60021953 AAATAAGGCTGAGACCTACTGGG - Intronic
1128309955 15:66624072-66624094 AAATAAGGCTGAGACCTACTGGG + Intronic
1128342008 15:66829029-66829051 AAATAAGGCTGAGACCTACTGGG + Intergenic
1130084920 15:80769985-80770007 AAATAAGGCTGAGACCTGCTGGG - Intergenic
1131113893 15:89782340-89782362 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1131229355 15:90648468-90648490 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1131352085 15:91710178-91710200 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1131551964 15:93364939-93364961 AAATAAGGCTGAGACCTACTGGG + Intergenic
1132253002 15:100348798-100348820 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1132318605 15:100908878-100908900 AGGTAAGGCTCCTACCTGCTGGG + Intronic
1132720891 16:1315119-1315141 GGGCAAAGCTGAGTCCTGCTGGG - Intronic
1133546800 16:6815384-6815406 AAGTAAGGCTGAGATCTACTGGG - Intronic
1133561851 16:6957699-6957721 AAATGACGCTGAGACCTGCTGGG - Intronic
1133655413 16:7857671-7857693 AAATAAGGCTGAGACCTACTGGG - Intergenic
1133844028 16:9437916-9437938 AAATAAGGCTGAGACCTACTGGG - Intergenic
1133962311 16:10505244-10505266 AAATAAGGCTGAGACCTTCTGGG + Intergenic
1134095909 16:11418275-11418297 AAGTAAGGCTGAGACCTACCAGG + Intronic
1134236897 16:12473586-12473608 AAGTGAGGCTGAGACCTACTGGG + Intronic
1134592356 16:15464915-15464937 AAATAAGGCTGAGACCTACTTGG - Intronic
1134605912 16:15571114-15571136 AAATAAGGCTGAGACCTACTGGG - Intronic
1135169680 16:20172893-20172915 AAATAAGGCTAAGACCTGCTGGG + Intergenic
1135308738 16:21389053-21389075 AAATAAGGCTAAGACCTGCTTGG - Intergenic
1135633278 16:24052887-24052909 AAATAAGGCTGAGACCTACTGGG - Intronic
1135667682 16:24349809-24349831 AAATGAAGCTGAGACCTGCTGGG - Intronic
1135838775 16:25854572-25854594 ACATAAGGCTGAGACCTACTGGG - Intronic
1136104392 16:28019112-28019134 AAATAAGGCTGAGACCTACTGGG + Intronic
1136148320 16:28329357-28329379 AAATAAGGCTAAGACCTGCTTGG - Intergenic
1136305481 16:29368184-29368206 AAATAAGGCTAAGACCTGCTTGG - Intergenic
1136679723 16:31951522-31951544 AGGTCCCTCTGAGATCTGCTGGG - Intergenic
1136870124 16:33799359-33799381 AAATAAGACTGAGACCTGCTGGG + Intergenic
1137042583 16:35626952-35626974 AAATAAGGCTGAGACCTGTTGGG + Intergenic
1137695349 16:50458117-50458139 AAATAAGGCTGAGACCTACTGGG + Intergenic
1137700531 16:50494740-50494762 AAATAAAGCTGAGACCTACTGGG + Intergenic
1137745301 16:50816128-50816150 AAATAAGGCTGAGACCTACTGGG - Intergenic
1138165188 16:54794723-54794745 AAGTAAGGCTGAGACCTACTGGG - Intergenic
1138169929 16:54839353-54839375 ATGAAACTCTGAGACATGCTGGG + Intergenic
1138247458 16:55478481-55478503 AAATGAGGCTGAGACCTGCTGGG - Intronic
1138632830 16:58312669-58312691 AAATGAGGCTGAGACCTGCTGGG - Intronic
1138787331 16:59863224-59863246 AAATAAGGCTGAGACCTACTGGG + Intergenic
1138851621 16:60636270-60636292 AAATAAGGCTAAGACCTGCTGGG + Intergenic
1138980123 16:62257964-62257986 AAATAATGCTGAGACCTACTGGG - Intergenic
1138980267 16:62259319-62259341 AAATAATGCTGAGACCTACTGGG + Intergenic
1139066517 16:63322403-63322425 AAGTGAGGCTGAGACCTACTGGG + Intergenic
1139736862 16:68997729-68997751 AGATGAGGATGAGACCTGCTGGG - Intronic
1140023652 16:71263476-71263498 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1140995036 16:80250852-80250874 AAATAAGGCTGAGACCTACTGGG + Intergenic
1141387254 16:83633209-83633231 AAATAAGGCTGAGACCTACTGGG - Intronic
1141752874 16:85970837-85970859 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1142026496 16:87816933-87816955 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1203082693 16_KI270728v1_random:1157035-1157057 AGGTCATTCTGAGATCTGCTGGG - Intergenic
1203102047 16_KI270728v1_random:1316695-1316717 AAATAAGACTGAGACCTGCTGGG - Intergenic
1143887969 17:10080010-10080032 AGATAAGTCTGAGACCTACTGGG + Intronic
1144144364 17:12382862-12382884 AAATAAGGTTGAGACCTGCTGGG - Intergenic
1144273130 17:13639030-13639052 AAATAAGGCTGAGACCTACTGGG + Intergenic
1144637890 17:16922521-16922543 AGGTAAGTCTGACACCTACTGGG - Intergenic
1145091165 17:19987294-19987316 AAATGAGGCTGAGACCTGCTAGG + Intergenic
1145226371 17:21131634-21131656 AAATAAGGCTGAGACCTACTGGG - Intronic
1145244417 17:21258837-21258859 AAATAAGGCTGAGACTTGCTGGG + Intergenic
1145724627 17:27107151-27107173 AAATAAGGCTGAGACCTGTTGGG - Intergenic
1145866228 17:28243543-28243565 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1146134003 17:30302453-30302475 AAATAAGGCTGAGACCTACTGGG - Intergenic
1146291595 17:31611484-31611506 AAATAAGGCTAAGACCTGCTGGG - Intergenic
1146295004 17:31642527-31642549 AAGTAAGGCTGAGACCTACTGGG + Intergenic
1146876389 17:36415732-36415754 AAATAAGGCTGAGTCCTGCTGGG - Intronic
1147062995 17:37897141-37897163 AAATAAGGCTGAGTCCTGCTGGG + Intergenic
1147465360 17:40606845-40606867 AAATAAGGCTGAGACTTGCTGGG - Intergenic
1147872229 17:43595694-43595716 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1148592357 17:48825904-48825926 AAATAAAGCTGAGACCTACTGGG - Intergenic
1149044051 17:52223952-52223974 AAATAAGGCTGAGAACTGCTGGG - Intergenic
1149215048 17:54344940-54344962 AAATAAGGCTGAGACCTACTGGG + Intergenic
1149484104 17:57028533-57028555 AAATAAGGCTGAGACCTTCTGGG - Intergenic
1149727939 17:58915520-58915542 AAATAAAGCTGAGACCTACTGGG - Intronic
1150348730 17:64424935-64424957 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1150348778 17:64425373-64425395 AAGTGAGGCTGAGACCTGCTGGG - Intergenic
1150350045 17:64437310-64437332 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1150611217 17:66734699-66734721 AAATAAGGCTGAGATCTGCTGGG - Intronic
1151911717 17:77087958-77087980 AAATAAAGCTGAGACCTACTTGG - Intronic
1152208197 17:78987827-78987849 AATTACGGCTGAGACCTGCTGGG + Intergenic
1152213441 17:79017671-79017693 AAATGATGCTGAGACCTGCTGGG + Intergenic
1152213533 17:79018321-79018343 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1153113235 18:1619685-1619707 AAATAAGGCTGAGACCTACTGGG - Intergenic
1153415088 18:4837671-4837693 AAATAAGGCTGAGACCTGTTGGG + Intergenic
1153682160 18:7511068-7511090 AAATAAGGCTGAGACCTACTGGG + Intergenic
1155294860 18:24375782-24375804 AGTAAACACTCAGACCTGCTGGG + Intronic
1156291193 18:35749854-35749876 AAATAAGGGTGAGACCTGCTGGG - Intergenic
1157741043 18:50093544-50093566 AAATGAGGCTGAGACCTGCTGGG + Intronic
1157792430 18:50544630-50544652 AAATAAGGCTGAGACCTACTGGG + Intergenic
1158571809 18:58602689-58602711 AACTAAGGCTGAGACCTACTGGG + Intronic
1158733315 18:60050569-60050591 AAATAAGGCTGAGACCTACTGGG - Intergenic
1159447257 18:68556179-68556201 AAATAAGGATGAGACCTGCTAGG - Intergenic
1159585581 18:70280757-70280779 AAGTAAGGCTGAGACCTACTGGG - Intergenic
1159864791 18:73691302-73691324 AGATGAGGCTGAGAGCTGCTGGG + Intergenic
1160654831 19:260115-260137 AAATAAGGATGAGACCTGCTGGG + Intergenic
1161190805 19:2954266-2954288 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1161640468 19:5419408-5419430 AAATAAGGCTGAGACCTACTGGG + Intergenic
1162941029 19:14009312-14009334 AAATGAGGCTGAGACCTGCTAGG + Intergenic
1163164475 19:15485975-15485997 AAATAAGGCTGAAACCTGCTGGG - Intronic
1163305635 19:16476616-16476638 AAATAAGGCTGAGACCTACTGGG - Intergenic
1163357442 19:16823304-16823326 AAATAAGGCTGAGACCTACTGGG + Intergenic
1164006370 19:21153324-21153346 AAATAACGCTGAGACCCACTGGG - Intronic
1164187789 19:22886507-22886529 AAATAACGCTGAGACCTGTTGGG + Intergenic
1164250608 19:23471391-23471413 AGGCAAGGCGGAGACCTGCAGGG + Intergenic
1164413799 19:28029027-28029049 AAATAAGGCTGAGACCTACTGGG + Intergenic
1164518610 19:28958973-28958995 AAATAAGGCTGAGACCTACTGGG + Intergenic
1164612712 19:29643787-29643809 AAATAAGGCTGAGACCTACTGGG + Intergenic
1165146114 19:33731642-33731664 AAATAAGGCTGAGACCTACTGGG - Intronic
1165335280 19:35165644-35165666 AAATAAGGCTGAGACCTACTGGG - Intronic
1166401879 19:42487638-42487660 AAATAAAGCTGAGACCTGCTGGG - Intergenic
1167381400 19:49140267-49140289 AGGGCACTCTGGGACCTGCTTGG + Intronic
1167585755 19:50374619-50374641 AAATAAGGCTGAGACCTACTGGG + Intronic
1167730449 19:51250501-51250523 AAATGAGGCTGAGACCTGCTGGG - Intronic
1167735471 19:51292043-51292065 AAATAAGGCTGAGACCTACTGGG - Intergenic
1167948242 19:53006677-53006699 AAATAAGCCTGAGACCTGCTGGG - Intergenic
924984129 2:253255-253277 AAATAAGGCTGAGACCTACTGGG + Intronic
925339618 2:3127086-3127108 AGGGAAGCCTGAGAGCTGCTGGG + Intergenic
925590255 2:5502256-5502278 AAATAAGGCTGAGACCTACTGGG + Intergenic
925892611 2:8448035-8448057 AAGTGAGGCTGAGACCTGCTGGG + Intergenic
925945639 2:8860446-8860468 GAGAAACGCTGAGACTTGCTTGG + Intronic
925980113 2:9169770-9169792 AAATAAGGCTGAGACCTACTGGG - Intergenic
926117518 2:10222773-10222795 AAATAAGGCTGAGACCTACTGGG + Intergenic
926340424 2:11900567-11900589 AAATAAGGCTGAGACCTACTGGG + Intergenic
926360698 2:12083920-12083942 AAATAAGGCTGAGACCTGCTGGG + Intergenic
927347154 2:22058221-22058243 ATATAAGGCTGAGATCTGCTGGG - Intergenic
927397721 2:22673553-22673575 AAATAAGGCTGAGACCTACTGGG + Intergenic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
929060380 2:37917993-37918015 AAATAAGGCTGAGACCTGCTCGG - Intergenic
929232370 2:39572954-39572976 AAATAAGGCTGAGACCTACTGGG - Intergenic
929987843 2:46754076-46754098 AAATAAGGCTGAGACCTACTGGG - Intronic
930063505 2:47310339-47310361 GGGTAAGGGTGAGGCCTGCTGGG - Intergenic
930117175 2:47728157-47728179 AAATAAGGTTGAGACCTGCTGGG - Intronic
930510111 2:52334328-52334350 AAATTAGGCTGAGACCTGCTGGG + Intergenic
930576708 2:53159369-53159391 AAATAAGGCTGAGACCTACTGGG + Intergenic
931368522 2:61640529-61640551 AAATAAGGCTGAGGCCTGCTGGG + Intergenic
931686836 2:64800974-64800996 AAATAAGGCTGAGACCTACTGGG + Intergenic
932159911 2:69450130-69450152 AAATAAGGCTGAGACCTACTGGG - Intergenic
933427317 2:82129519-82129541 AGATGACGGTGAGACCTACTGGG + Intergenic
933457953 2:82541022-82541044 AAATAAGGCTGAGACTTGCTGGG - Intergenic
933840658 2:86283553-86283575 TGGTAAAGCTGACCCCTGCTTGG - Intronic
935472930 2:103480937-103480959 AAATAAGGCTGAGACCTACTGGG - Intergenic
935724684 2:106013175-106013197 AAATAAGGCTGAGACCTACTGGG + Intergenic
935743042 2:106167784-106167806 AAGTGAGGCTGAGACCTACTGGG + Intronic
935783737 2:106530664-106530686 AGATGGGGCTGAGACCTGCTAGG + Intergenic
935784032 2:106532908-106532930 AAATAAGGCTGAGACCTGCTGGG - Intergenic
936515620 2:113179658-113179680 AAATAAGGCTGAGACCTACTGGG - Intronic
937678190 2:124614844-124614866 AAATAAGGCTGAGACCTACTGGG - Intronic
939047681 2:137268760-137268782 AAATAAGGCTGAGACCTACTGGG - Intronic
939500754 2:142980434-142980456 AAATAAGGCTGAGACCTGCTGGG - Intronic
939736543 2:145854269-145854291 AAATAAGGCTGAGACCTGCTGGG + Intergenic
939843529 2:147217020-147217042 AAATAAGGCTGAGACCTACTGGG - Intergenic
939843995 2:147221463-147221485 AAATAAGGCTGAGACCTACTGGG - Intergenic
939896957 2:147803064-147803086 TGGTAACACTGAGACCTTATAGG + Intergenic
940190709 2:151037375-151037397 AAATAAGGCTGAGACCTACTGGG + Intronic
940773065 2:157859082-157859104 AAATAAGGCTGAGACCTACTGGG + Intronic
941286942 2:163626679-163626701 AAGTAAGGCTGAGACCTACTGGG + Intronic
941715197 2:168756249-168756271 AGATAAGGCTGACTCCTGCTAGG - Intronic
941876813 2:170441963-170441985 AAATAAGGCTGAGACCTACTGGG - Intronic
941993420 2:171578570-171578592 AAGTGAGGCTGAGACCTACTGGG - Intergenic
942870243 2:180725939-180725961 AAATAAGGCTGAGACCTACTGGG - Intergenic
942925821 2:181430777-181430799 AAATAAGGCTGAGACCTACTGGG - Intergenic
943062133 2:183050266-183050288 AAGTAGTGCTGAGACCAGCTCGG + Intergenic
943466974 2:188240119-188240141 AAATAAAGCTGAGACCTACTGGG + Intergenic
943778593 2:191795404-191795426 AGGTAACCCTGATTCATGCTAGG - Intergenic
943826985 2:192407899-192407921 AGGGAAAGATGACACCTGCTTGG + Intergenic
944334952 2:198521341-198521363 ATGTAACTCTGAGACCAGCAAGG + Intronic
944519714 2:200552866-200552888 AAATAAGGCTGAGACCTTCTGGG - Intronic
944714176 2:202362351-202362373 AAATGATGCTGAGACCTGCTGGG - Intergenic
945168701 2:206973404-206973426 AAATAAGGCTGAGACCTACTGGG - Intergenic
945252091 2:207772331-207772353 AAATAAGGCTGAGACCTACTGGG + Intergenic
945255331 2:207798475-207798497 AAATAAGGCTGAGACCTACTGGG + Intergenic
946440140 2:219688094-219688116 AAATGAGGCTGAGACCTGCTGGG - Intergenic
946444485 2:219726685-219726707 AAATAAGGCTGAGACCTACTGGG - Intergenic
946461884 2:219876155-219876177 AAATAAGGCTGAGACCTACTGGG + Intergenic
946548815 2:220777636-220777658 AAGGAAAGCTGAGAACTGCTGGG + Intergenic
946551383 2:220805374-220805396 AAATAAGGCTGAGACCTACTGGG + Intergenic
946730547 2:222705345-222705367 AAATAAGGCTGAGACCTACTGGG - Intronic
946845402 2:223854423-223854445 AAATAAGGCTGAGACCTCCTGGG + Intergenic
947975792 2:234364678-234364700 AAATAAGGCTGAGACCAGCTGGG + Intergenic
948902692 2:240964385-240964407 AGGGGAGGCAGAGACCTGCTGGG + Intronic
948971611 2:241432278-241432300 AGGTAAGTGTGAGACCAGCTAGG - Intronic
1169192268 20:3665964-3665986 AAATAAGGCTGAGACCTACTGGG - Intergenic
1169286370 20:4310807-4310829 AAATGACGCTGAGACCTGCTGGG - Intergenic
1169565833 20:6852635-6852657 AAATAAAGCTGAGACCTACTGGG - Intergenic
1170063707 20:12287759-12287781 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1170386121 20:15818664-15818686 AAATGAGGCTGAGACCTGCTGGG - Intronic
1170820019 20:19749563-19749585 AAATAAGGCTGAGACCTACTGGG + Intergenic
1171171624 20:23020479-23020501 AAATAAGGCTGAGACCTACTGGG + Intergenic
1171204580 20:23268819-23268841 AGGTAATGATGAGTACTGCTGGG + Intergenic
1171327530 20:24308686-24308708 AAATAAGGCTGAGACCTACTGGG + Intergenic
1171363107 20:24604281-24604303 AGGTAACGCTGAGACCTGCTGGG + Intronic
1172362234 20:34321255-34321277 ATGAGAGGCTGAGACCTGCTGGG + Intergenic
1172367005 20:34357815-34357837 AAATAAGGCTGAGACCTACTGGG + Intergenic
1172585765 20:36083316-36083338 AAATAAGGCTAAGACCTGCTGGG + Intergenic
1172798447 20:37559519-37559541 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1172904385 20:38358113-38358135 AAATGAGGCTGAGACCTGCTGGG - Intronic
1173357504 20:42307762-42307784 AAATAAGGCTGAGACCTACTGGG + Intronic
1173532667 20:43782433-43782455 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1173661315 20:44735933-44735955 AAATAAGGCTGAGACCTGCTGGG - Intergenic
1173731439 20:45331475-45331497 AAATAAGGCTGAGACCTGCTGGG + Intronic
1173746698 20:45442987-45443009 AAATAAGGCTGAGACCTGCTGGG - Intergenic
1173752691 20:45489387-45489409 AAATAAGGGTGAGACCTGCTTGG - Intergenic
1174102747 20:48139699-48139721 AAATAAGGCTGAGACCTACTGGG - Intergenic
1174105227 20:48157164-48157186 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1174122744 20:48278981-48279003 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1174324190 20:49766119-49766141 AAATAAGGCTGAGACCTACTGGG - Intergenic
1174547821 20:51339107-51339129 AAATAAGGCTGAGACCTACTAGG - Intergenic
1174608371 20:51778261-51778283 AAATAAAGCTGAGACCTACTGGG + Intergenic
1175215524 20:57390137-57390159 AGGAAACGCGGAGAACTCCTCGG + Intergenic
1175444761 20:59012396-59012418 AAATAAGGCTGAGACCTCCTGGG - Intergenic
1177174617 21:17690291-17690313 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1177842022 21:26245374-26245396 AAGTAAGGCTGAGACCTACTGGG + Intergenic
1177882873 21:26715337-26715359 AAGTGAAGCTGAGACCTACTGGG - Intergenic
1178479155 21:32964091-32964113 AAATAAGGCTGAGACCTACTGGG + Intergenic
1178514487 21:33235277-33235299 AAATGAGGCTGAGACCTGCTGGG - Intronic
1178522853 21:33300853-33300875 AAGTAAGGCTGAAACCTACTGGG + Intergenic
1179112429 21:38458908-38458930 AGGTAACAAAGAGACCAGCTGGG - Intronic
1179400726 21:41080688-41080710 AAATAAGGCTGAGACTTGCTGGG + Intergenic
1179629689 21:42668778-42668800 AGGTCACGCTCAGAGCTGCCTGG - Intronic
1179674541 21:42973133-42973155 AACTGAAGCTGAGACCTGCTGGG - Intergenic
1179990906 21:44947839-44947861 AGGCAAAGCTGAGTCCTGCTGGG - Intronic
1180131929 21:45832425-45832447 AAATAAGGCTGAGACCTGTTGGG - Intronic
1180242457 21:46519346-46519368 AAATAAGGCTGAGATCTGCTGGG - Intronic
1181953015 22:26568366-26568388 AAATGAGGCTGAGACCTGCTGGG + Intronic
1182454738 22:30443083-30443105 AAATAAAGCTGAGACCTACTGGG - Intergenic
1182965462 22:34517465-34517487 AAATAAGGCTGAGACCTACTGGG + Intergenic
1183113246 22:35668751-35668773 AAATAAGGCTGAGACCTCCTGGG + Intergenic
1183113737 22:35673495-35673517 AAATAAGGCTGAGACCTCCTGGG + Intergenic
1183326198 22:37196035-37196057 AAATAGGGCTGAGACCTGCTGGG - Intronic
1184338314 22:43869127-43869149 AAATAATGCTGAGACCTACTGGG + Intergenic
1185348467 22:50321032-50321054 AGGTCAGGCTGTGCCCTGCTCGG + Intronic
949098412 3:113946-113968 AAATAAGGCTGAGACCTACTGGG + Intergenic
949113156 3:287078-287100 AAATAAGGCTGAGACCTACTGGG - Intronic
950229685 3:11265738-11265760 AAGTAAGGTTGAGACCTACTGGG + Intergenic
950230128 3:11269165-11269187 AAGTAAGGCTGAGACCTATTGGG - Intergenic
950772482 3:15323430-15323452 AGGGAGGGCTGAGACCCGCTGGG - Intronic
950780485 3:15387453-15387475 AAATAAAGCTGAGACCTACTGGG - Intronic
951894208 3:27595578-27595600 AAATAAGGCTGAGACCTACTGGG - Intergenic
953011080 3:39025820-39025842 AAATAAGGCTGAGACCTACTAGG - Intergenic
953320385 3:41966156-41966178 AAATAAGGCTGAGACCTTCTGGG + Intergenic
953427611 3:42808107-42808129 AGATAAGGCTGAGACCTACTGGG - Intronic
953521700 3:43649094-43649116 AAATAAGGCTGAGACCTACTGGG - Intronic
953610217 3:44441454-44441476 AAATAAGGCTGAGACCTACTGGG - Exonic
953684410 3:45065196-45065218 AAATAAGGCTGAGACCTACTGGG - Intergenic
954484307 3:50832621-50832643 AAATAAGGCTGAGACCTACTGGG - Intronic
954936988 3:54335671-54335693 AAATAAGGCTGAGACCTACTGGG - Intronic
955417575 3:58706624-58706646 AAATGAGGCTGAGACCTGCTGGG + Intergenic
955567255 3:60260670-60260692 AAATAAGGCTGAGACCTACTGGG + Intronic
956446185 3:69328486-69328508 AAATAAGGCTGAGACCTACTGGG + Intronic
956709768 3:72028963-72028985 AAGTGAGGCTGAGACCTACTGGG - Intergenic
957476674 3:80734472-80734494 AAATAAGGCTGAGACCTACTGGG + Intergenic
958038411 3:88196315-88196337 AAATAAGGCTGAGACCTACTGGG - Intergenic
958890495 3:99777132-99777154 AAATAAGGCTGAGACCTACTGGG - Intronic
959064630 3:101644041-101644063 AAATAAGGCTGAGACCTACTGGG + Intergenic
959161662 3:102732062-102732084 AAATAAGGCTGAGACCGGCTGGG + Intergenic
959680973 3:109096269-109096291 AAATAAGGCTGAGACCTACTGGG + Intronic
959884248 3:111480226-111480248 AAATAAGACTGAGACCTGCTTGG - Intronic
960627870 3:119699109-119699131 AAATAAGGCTGAGACCTACTGGG + Intergenic
962095258 3:132286251-132286273 AAATAAGGCTGAGACCTACTGGG + Intergenic
962119268 3:132544725-132544747 ATATAAGGCTGAGACCTGCTGGG + Intergenic
962749826 3:138425680-138425702 AAGTGAGGCTGAGACCTACTGGG - Intergenic
962795591 3:138847037-138847059 AAATAAGGCTGAGACCTACTGGG + Intergenic
964075035 3:152683616-152683638 AGTTTTCGCTGAGGCCTGCTGGG + Intergenic
964281920 3:155077074-155077096 AAATAAGGCTGAGACCTGCTGGG - Intronic
964855290 3:161139829-161139851 AAATGAGGCTGAGACCTGCTGGG + Intronic
965185530 3:165457317-165457339 AAATGAGGCTGAGACCTGCTGGG - Intergenic
966034912 3:175399778-175399800 AAATAAGGCTGAGACCTTCTGGG - Intronic
966106995 3:176347917-176347939 AAATAAGGCTGAGACCTACTGGG - Intergenic
966721597 3:183068183-183068205 AAATAAGGCTAAGACCTGCTGGG + Intronic
967134700 3:186503573-186503595 AAATAAGGCTGGGACCTGCTGGG - Intergenic
967606169 3:191449676-191449698 AAATAAAGCTGAGACCTACTGGG - Intergenic
967655198 3:192039796-192039818 AGGTAAAGCTGTGCCCTGTTAGG + Intergenic
969087858 4:4669832-4669854 AAATAAGGCTGAGACCTGCTGGG + Intergenic
969303979 4:6314588-6314610 AAATGAGGCTGAGACCTGCTGGG + Intergenic
969614261 4:8243068-8243090 AAGTGAGGCTGAGACCTGCCGGG + Intergenic
970221135 4:13812278-13812300 AAATAAGGCTGAGACCTACTGGG + Intergenic
970933805 4:21544970-21544992 AAATAAGGCTGAGATCTGCTGGG + Intronic
971452362 4:26811987-26812009 AAATAAGGCTGAGACCTACTGGG - Intergenic
973581777 4:52351080-52351102 AAGTGAGGCTGAGACTTGCTGGG - Intergenic
973795256 4:54418587-54418609 AAATAAGGCTGAGACCTACTGGG - Intergenic
973942603 4:55925754-55925776 AAATAAGGCTGAGACCTACTGGG - Intergenic
974721461 4:65744268-65744290 AAATGAGGCTGAGACCTGCTAGG + Intergenic
975206340 4:71648000-71648022 AAATAAGGCTGAGACCTACTGGG - Intergenic
975998985 4:80349019-80349041 AAGTCACACTGAGACCTGCAAGG + Intronic
976004834 4:80417398-80417420 AAATAAGGCTGAGACCTCCTGGG - Intronic
976747180 4:88414889-88414911 AAATAAGGCTGAGACCTACTGGG - Intronic
977048090 4:92091674-92091696 AAATAAGGCTGAGACCTACTGGG - Intergenic
977500872 4:97835038-97835060 AAATAAGGCTGAGACATGCTGGG + Intronic
977590248 4:98818263-98818285 AAATAAGGCTGCGACCTGCTGGG + Intergenic
977592770 4:98844874-98844896 AAATAAGGCTGAGACCTGCTGGG - Intergenic
978223476 4:106305640-106305662 AAGTGAGGCTGAGACCTACTGGG + Intronic
978229953 4:106386063-106386085 AGGGAAGGCTGAGAGCAGCTCGG - Intergenic
978800768 4:112753497-112753519 AAATGAAGCTGAGACCTGCTGGG + Intergenic
978970020 4:114792318-114792340 AAATAAGGCTGAGACCTACTGGG - Intergenic
979067497 4:116156835-116156857 AAATAAGGCTGAGACCTACTGGG - Intergenic
979292024 4:118988962-118988984 AGGGAACTGTAAGACCTGCTTGG - Intronic
979631374 4:122906676-122906698 AAATAAGGCTGAGACCTGCTGGG + Intronic
979720214 4:123891155-123891177 AAATAAGGCTGAGACCTGCTGGG + Intergenic
980014233 4:127630332-127630354 AAATAAGGCTGAGACCTACTGGG - Intronic
980245930 4:130243088-130243110 AAATAAGGCTGAGACCTACTGGG + Intergenic
980625399 4:135369013-135369035 AAATAAGGCTGAGACCTACTGGG + Intergenic
980720926 4:136694417-136694439 AAATAAGGCTGAGACCTGCTGGG - Intergenic
981052163 4:140320029-140320051 AAATAAGGCTGAGACCTACTGGG + Intronic
981318246 4:143362848-143362870 AAATAAGGCTGAGACCTACTGGG - Intronic
981362881 4:143867235-143867257 AAATAAGGCTGAGACCTGCTGGG - Intergenic
981373610 4:143988035-143988057 AAATAAGGCTGAGACCTGCTGGG - Intergenic
981382711 4:144091306-144091328 AAATAAGGCTGAGACCTGCTGGG - Intergenic
982055872 4:151548371-151548393 AAATAAGGCTGAGACCTGCTGGG + Intronic
982472534 4:155810738-155810760 AAATGAGGCTGAGACCTGCTGGG + Intergenic
982479208 4:155888384-155888406 AAATAAGGCTGAGATCTGCTGGG - Intronic
982524121 4:156456186-156456208 AAATAAGGCTGAGACCTACTGGG + Intergenic
982644809 4:158009966-158009988 AAATAAGGCTGAGACCTACTGGG - Intergenic
982651646 4:158094823-158094845 AAATGAGGCTGAGACCTGCTGGG + Intergenic
982863913 4:160487233-160487255 AAATAAGGCTGAGACCTACTTGG + Intergenic
983080999 4:163385632-163385654 AAATAAGGCTGAGACCTGCTGGG + Intergenic
983878085 4:172900071-172900093 AAATAAGGCTGAGACCTACTGGG - Intronic
983995439 4:174176138-174176160 AAATAAGGCTGAGACCTACTGGG - Intergenic
984016281 4:174430648-174430670 AGGGAACTTTGAGACCTGATTGG - Intergenic
984118025 4:175706721-175706743 AAATAAGGCTGAGACCTGCTGGG + Intronic
984601192 4:181728783-181728805 AAAGAAAGCTGAGACCTGCTGGG - Intergenic
984872555 4:184339868-184339890 AAATAAAGCTGAGACCTTCTGGG - Intergenic
984934581 4:184879043-184879065 AGGCGAGGCTGAGACCTGCAAGG - Intergenic
986232925 5:5883637-5883659 AGGAAACACAGGGACCTGCTGGG + Intergenic
986460150 5:7961705-7961727 AAATAAGGCTGAGACCTACTGGG - Intergenic
987373283 5:17212615-17212637 AAGTAAGGCTGAGACCTACTGGG - Intronic
987753023 5:22066086-22066108 AGGTAAGGCTGAGATCTCTTGGG + Intronic
987858209 5:23448781-23448803 AAATAAGGCTGAGACCTACTGGG - Intergenic
988087208 5:26487454-26487476 AAATAAGGCTGAGACCTACTGGG - Intergenic
988184422 5:27841766-27841788 AAATAAGGCTGAGACCTACTGGG + Intergenic
988453031 5:31362282-31362304 ACATAAGGCTGAGACCTTCTGGG - Intergenic
988781140 5:34522797-34522819 AAATAAGGCTGAGACCTGCTGGG - Intergenic
988831303 5:34989945-34989967 AAATAAGGCTGAGACCTCCTGGG + Intergenic
989445848 5:41527397-41527419 AAATAAGACTGAGACCTGCTTGG + Intergenic
990018706 5:51099361-51099383 AAGTAAGTCTGAGACCTACTGGG + Intergenic
990076867 5:51856637-51856659 AAGTAAGGCTGAGACCTACTGGG - Intergenic
990120805 5:52449230-52449252 AGTCAACTCTGAGAACTGCTGGG - Intergenic
990340917 5:54822168-54822190 AAATAAAGCTGAGACCTGTTGGG + Intergenic
990670729 5:58127325-58127347 AGGTAGCTCCCAGACCTGCTGGG + Intergenic
990886462 5:60599981-60600003 AGGGAATGCCGAGACCAGCTCGG - Intronic
990951416 5:61302178-61302200 AGGTAACGCAGACCTCTGCTAGG + Intergenic
991676073 5:69091152-69091174 AAATAAGGCTGAGACCTACTGGG - Intergenic
992159770 5:73989921-73989943 AAATAAGGCTGAGACCTACTGGG - Intergenic
992796665 5:80259713-80259735 AAATAAGGCTGTGACCTGCTGGG + Intergenic
993717734 5:91292123-91292145 AAATAAGGCTGAGAGCTGCTGGG - Intergenic
993829896 5:92742122-92742144 AAATAAGGCTGAAACCTGCTGGG - Intergenic
993965900 5:94360398-94360420 AAATAAGGCTGAGACCTGCTGGG + Intronic
994185366 5:96809294-96809316 AAATAAGGCTGAGACCTACTGGG - Intergenic
994520056 5:100822721-100822743 AAATAAGACTGAGACCTGCTGGG + Intronic
995605975 5:113855307-113855329 GGGTAATGCCGAGACCAGCTTGG - Intergenic
996334080 5:122364153-122364175 AAATGAGGCTGAGACCTGCTGGG + Intronic
996684879 5:126269149-126269171 ACATAATGCTGAGACCTACTGGG - Intergenic
996707797 5:126514524-126514546 AAATAAGGCTGAGACCTGCTGGG - Intergenic
996998455 5:129727887-129727909 AAATAAGGCTGAGACCTACTGGG + Intronic
998880560 5:146640954-146640976 AAGGAAGACTGAGACCTGCTGGG - Intronic
999321451 5:150617996-150618018 AGGTGACCCTGAGAACTGGTCGG - Intronic
1000311023 5:160044794-160044816 AAATAAGGCTGAGACCTACTGGG - Intronic
1000325283 5:160167422-160167444 AAATAATGCTGAGACCTACTGGG - Intergenic
1000370997 5:160536502-160536524 ACATGAGGCTGAGACCTGCTGGG + Intergenic
1000600956 5:163273959-163273981 AAATAAGGCTGAGACCTACTGGG - Intergenic
1000878441 5:166668836-166668858 AAACAAGGCTGAGACCTGCTGGG + Intergenic
1001339469 5:170830100-170830122 AAATAAGGCTGAGACCTACTGGG + Intergenic
1001488419 5:172137215-172137237 AAATGAGGCTGAGACCTGCTGGG - Intronic
1001510216 5:172315420-172315442 AAGTGAGGCTAAGACCTGCTGGG + Intergenic
1002371643 5:178759691-178759713 AAATAAGGCTGAGACCTACTGGG - Intergenic
1003372492 6:5542218-5542240 AAATAAGGATGAGACCTGCTGGG - Intronic
1003618990 6:7680853-7680875 AAATAAGGTTGAGACCTGCTGGG - Intergenic
1004390687 6:15207165-15207187 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1004909908 6:20272947-20272969 AAATAAGGCTGAGACCTACTGGG - Intergenic
1005018849 6:21398884-21398906 AAATAAGGCTGAGACCTACTGGG + Intergenic
1005448591 6:25951740-25951762 AAATAAGGCTGAGGCCTGCTGGG - Intergenic
1005448996 6:25954938-25954960 AAATAAGGCTGACACCTGCTAGG - Intergenic
1005449040 6:25955266-25955288 AAATAAGGCTGAGTCCTGCTGGG + Intergenic
1005449755 6:25961382-25961404 AAATAAGGCTGAGACCTACTGGG - Intergenic
1005615493 6:27568553-27568575 AAATAAGGCTGAGACCTACTGGG + Intergenic
1005804911 6:29465457-29465479 AAGTAAGGCTGAAACCTGCTGGG + Intergenic
1005983417 6:30854858-30854880 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1006286984 6:33104171-33104193 AGGGAACCCTGAGATCTCCTTGG - Intergenic
1008570932 6:52815748-52815770 TGGTAACGCTGGGGACTGCTTGG + Intergenic
1013208330 6:107964739-107964761 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1013476241 6:110509865-110509887 AAATAAGGCTGAGACCTACTGGG + Intergenic
1014351767 6:120354553-120354575 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1014916927 6:127161975-127161997 AATTAAGGCTGAGACCTACTGGG + Intronic
1016006287 6:139092301-139092323 AAATAAGGCTGAGACCTACTGGG + Intergenic
1016295693 6:142571875-142571897 AAATAAGGCTGAGACCTACTGGG + Intergenic
1016297114 6:142585326-142585348 AAATAAGGCTGAGACCTACTAGG + Intergenic
1016513940 6:144872991-144873013 AAATAAGGCTGAGACCTACTGGG - Intergenic
1016686442 6:146887621-146887643 AAATAAGGCTGAGACCTGCGGGG - Intergenic
1016699179 6:147034517-147034539 AAATAAGGCTGAGACCTACTGGG + Intergenic
1016832211 6:148445271-148445293 AAATAAGGCTGAGACCTGCTGGG - Intronic
1016849479 6:148602183-148602205 AGGAACTGCTGAGACCAGCTCGG - Intergenic
1017256039 6:152334821-152334843 AAATGAGGCTGAGACCTGCTGGG - Intronic
1017392873 6:153959978-153960000 AAATAAGGCTGAGACCTACTGGG + Intergenic
1017406391 6:154123983-154124005 AAATAAGGCTGAGACCTACTGGG - Intronic
1017571067 6:155744877-155744899 AGGTGACTCTGAGAGCTGCTAGG - Intergenic
1018138274 6:160800034-160800056 AAATAAGGCTGAGACCTACTGGG + Intergenic
1018435824 6:163758103-163758125 AAATAAGGCTGAGACCTACTGGG + Intergenic
1019038851 6:169086209-169086231 AAACAAGGCTGAGACCTGCTGGG + Intergenic
1019707236 7:2502537-2502559 AGGAAAGGCTGAGGCCTCCTGGG + Intergenic
1019951339 7:4375509-4375531 AAATAAGGCTGAGACCTACTGGG + Intergenic
1020355043 7:7266479-7266501 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1021309817 7:19080174-19080196 AAATGAGGCTGAGACCTGCTGGG + Intronic
1022272718 7:28826012-28826034 AAATAAGGCTGAGACCTACTGGG + Intergenic
1022373877 7:29795122-29795144 AAGTAAGGCTGAGACCTACTGGG - Intergenic
1022532381 7:31075149-31075171 AGGTAAAGCAGGGACCTGCAAGG - Intronic
1023013644 7:35944460-35944482 AGGAAACTTTGAGAACTGCTGGG - Intergenic
1023046854 7:36217567-36217589 AAATAAGGCTGAGACCTACTAGG - Intronic
1023588020 7:41751158-41751180 AAATAAGGCTGAGACCTGCTGGG - Intergenic
1024039917 7:45544697-45544719 AAATAAGGCTGAGACCTACTGGG + Intergenic
1024077486 7:45829374-45829396 AGGAAACTTTGAGAACTGCTGGG + Intergenic
1024630023 7:51239184-51239206 AAATTAGGCTGAGACCTGCTGGG + Intronic
1024641197 7:51329984-51330006 AAATAAGGCTAAGACCTGCTGGG - Intergenic
1025005394 7:55350430-55350452 AAATAAGGCTGAGACCTACTGGG + Intergenic
1025126924 7:56352033-56352055 AGGAAACTTTGAGAACTGCTGGG - Intergenic
1025849413 7:65233730-65233752 AGATAAGGCTGAGACCTACTGGG + Intergenic
1026084893 7:67254905-67254927 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1026097751 7:67360104-67360126 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1026119753 7:67526407-67526429 AAATAAGGCTGAGACCTACTGGG + Intergenic
1026222094 7:68407685-68407707 AAATAAGGCTGAGACCTACTGGG + Intergenic
1026493048 7:70879787-70879809 AAATAAGGCTGAGACCTACTGGG + Intergenic
1026562365 7:71461013-71461035 AAATAAGGCTGAGACCTACTGGG - Intronic
1026583660 7:71638361-71638383 AGATAAAGCTGAGACCTACTGGG - Intronic
1026692281 7:72560015-72560037 AAATGAGGCTGAGACCTGCTGGG + Intronic
1026917956 7:74133815-74133837 AGATGAGGCTGAGACCTGCTGGG + Intergenic
1027796229 7:82696847-82696869 AGATAAGGCTGAGACCTACTGGG - Intergenic
1027796455 7:82700019-82700041 AAATAAGGCTGAGACCTGATGGG + Intergenic
1028389296 7:90296085-90296107 AAATAAGGCTGAGACCTACTGGG - Intronic
1028731652 7:94158018-94158040 AAATAAGGCTGAGACCTACTGGG - Intergenic
1028985003 7:97002677-97002699 AGGTCCTGCTGAAACCTGCTGGG - Intergenic
1030610118 7:111680110-111680132 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1030699677 7:112623974-112623996 AAATAAAGCTGAGACCTACTGGG - Intergenic
1032056984 7:128691480-128691502 AAATAAGGCTGAGACCTACTGGG + Intergenic
1032123078 7:129170761-129170783 AAATAAGGCTGAGACCTACTGGG - Intergenic
1032338654 7:131050085-131050107 AAATAAGGCTGAGACCTACTAGG - Intergenic
1032986803 7:137346205-137346227 AAATAAGGCTGAGACCTACTGGG - Intergenic
1033433692 7:141313014-141313036 AAATAAGGCTGAGACCTACTGGG - Intronic
1033718863 7:144035568-144035590 AAATAAGGCTGAGACCTACTGGG + Intergenic
1033837214 7:145329899-145329921 AAATAAGGCTGAGACCTGCTGGG - Intergenic
1034914005 7:155021963-155021985 AAATAAGGCTGAGACCTACTGGG - Intergenic
1035924887 8:3716695-3716717 AAGTAAGGCTGAGGCCTGCTGGG - Intronic
1036146901 8:6262263-6262285 AAATGAAGCTGAGACCTGCTGGG - Intergenic
1036459889 8:8942666-8942688 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1036575984 8:10028069-10028091 ATATAAGGCTGAGACCTGCTGGG + Intergenic
1036747178 8:11418148-11418170 AAATGAGGCTGAGACCTGCTGGG - Intronic
1036809097 8:11854894-11854916 AGGTAACGCTGATTCCTCCACGG - Intronic
1037188804 8:16097544-16097566 AAATAAGGCTGAGACCTACTAGG + Intergenic
1037586075 8:20276993-20277015 AAATAAGGCTGAGACCTACTGGG + Intronic
1037613934 8:20500215-20500237 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1038652203 8:29415179-29415201 AAATAAGGCTGAGACCTACTGGG + Intergenic
1038743954 8:30239689-30239711 AGGTGAAGCTGGGACCTGGTGGG - Intergenic
1039049922 8:33483993-33484015 AAATAAGGCTGAGATCTGCTAGG - Intronic
1039084326 8:33764774-33764796 AAATAAGGCTGAGACTTGCTGGG - Intergenic
1039287536 8:36058606-36058628 AAATAAAGCTGAGACCTACTGGG - Intergenic
1039604108 8:38866729-38866751 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1039621892 8:39005015-39005037 AAATAAGGCTGAGACCTACTGGG - Intronic
1039882099 8:41631366-41631388 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1040417519 8:47208342-47208364 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1041918045 8:63155530-63155552 AAATAAGGCTGAGACCTACTGGG - Intergenic
1042125757 8:65535774-65535796 AATTAAGGCTGAGACCTACTGGG + Intergenic
1042309507 8:67366394-67366416 AAATAAGGCTGAGACCTTCTGGG + Intergenic
1043004133 8:74796977-74796999 AAATAAGGCTGAGACCTACTGGG - Intronic
1043023828 8:75041483-75041505 AAATAAGGCTGAGACCTACTGGG - Intergenic
1043936052 8:86143751-86143773 AAATAAGGCTGAGACCTACTGGG - Intronic
1044441274 8:92227254-92227276 AAATAAGGCTGGGACCTGCTGGG + Intergenic
1044586555 8:93874175-93874197 AAATGAGGCTGAGACCTGCTGGG - Intronic
1045457125 8:102391770-102391792 AAGTAAGGCTGAGACCTACTAGG + Intronic
1045691273 8:104762389-104762411 AAATAAGGCTGAGACCTACTGGG - Intronic
1045691427 8:104763711-104763733 ATATAAGGCTGAGACCTACTGGG - Intronic
1047526677 8:125639989-125640011 AAATAAGGCTGAGACCTACTGGG + Intergenic
1047540106 8:125756441-125756463 AAATAAGGCTGAGACCTGCTGGG - Intergenic
1048324242 8:133426787-133426809 AAATAAGGCTGAGACCTACTGGG + Intergenic
1049362918 8:142220768-142220790 TGGTGACCCTGAGACCTGGTGGG - Intronic
1049367010 8:142244693-142244715 ATGGAACGATGAGACCTGGTTGG - Intronic
1050087233 9:1978675-1978697 AGGTTTTGCTGAAACCTGCTGGG - Intergenic
1050141926 9:2525030-2525052 AAGTGAGGATGAGACCTGCTGGG + Intergenic
1050624186 9:7486259-7486281 AGCTGAGGCTGAGGCCTGCTGGG - Intergenic
1050932471 9:11347891-11347913 AAATAAGGCTGAGACCTGCTAGG - Intergenic
1051030384 9:12667525-12667547 AAATAAGGCTAAGACCTGCTGGG - Intergenic
1053228726 9:36386553-36386575 AAATAAGACTGAGACCTGCTGGG + Intronic
1054796548 9:69307494-69307516 AAATAAGGCTGAGACCTACTGGG - Intergenic
1055348340 9:75359754-75359776 AAATAAGGCTGAGACCTACTGGG - Intergenic
1055706251 9:79008267-79008289 AGATAATGCTGAGTCATGCTAGG - Intergenic
1057147628 9:92768886-92768908 AAATAAGGCTGAGACCTACTGGG + Intergenic
1057221654 9:93260786-93260808 AGCTGCCGCTGAAACCTGCTGGG - Intronic
1057358580 9:94352502-94352524 AAATAAGGCTGAGACCTGCTGGG - Intergenic
1057649171 9:96905108-96905130 AAATAAGGCTGAGACCTGCTGGG + Intronic
1057888754 9:98852124-98852146 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1057988928 9:99747220-99747242 AAATAAGGCTGAGACCTACTGGG + Intergenic
1061362223 9:130150988-130151010 AAGTAAGGCTGAGACCTACTGGG - Intergenic
1061636037 9:131908932-131908954 AAATAAGGCTGAGACCTTCTGGG - Intronic
1062221912 9:135420887-135420909 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1185703713 X:2250776-2250798 ACATGAGGCTGAGACCTGCTTGG - Intronic
1185749452 X:2599119-2599141 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1185785799 X:2889988-2890010 ACATGAGGCTGAGACCTGCTGGG - Intergenic
1185849296 X:3470334-3470356 ACATGAGGCTGAGACCTGCTGGG + Intergenic
1185880109 X:3733144-3733166 AAATAAGGCTGAGACCTACTGGG - Intergenic
1185929101 X:4182209-4182231 AAATGAGGCTGAGACCTGCTGGG - Intergenic
1185983231 X:4802908-4802930 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1186017454 X:5213956-5213978 AGGGAACCCTAAGACCAGCTTGG - Intergenic
1186089053 X:6024457-6024479 ACGTAAGGCTGGGACCTACTGGG + Intronic
1186123318 X:6385786-6385808 AAGTAAGGCTGAGATCTGCTGGG - Intergenic
1186802144 X:13104028-13104050 AAATAAGGCTGAGACCTGCTGGG - Intergenic
1187179625 X:16931695-16931717 AAATAAGGCTGAGACCTGTTGGG + Intergenic
1187306510 X:18099903-18099925 AAATGAGGCTGAGACCTGCTGGG + Intergenic
1187417121 X:19103017-19103039 AAATAAGGCTGAGACCTGTTGGG + Intronic
1187499771 X:19830169-19830191 AAATAAGGCTGAGACCTACTGGG - Intronic
1188126261 X:26373300-26373322 AAATAAGGCTGAGACCTACTGGG - Intergenic
1188126588 X:26375581-26375603 AAATAAGGCTGAGACCTACTGGG - Intergenic
1188284333 X:28310022-28310044 AAATAAGGCTGAGACCTACTGGG + Intergenic
1188626317 X:32289469-32289491 AAATAAGGCTGAGACCTACTGGG + Intronic
1189691071 X:43617344-43617366 AAATAAGGCTGAGACCTGCTGGG - Intergenic
1190137448 X:47809544-47809566 AAATAAGGCTGAGACCTACTGGG - Intergenic
1190244233 X:48680373-48680395 AAATAAGGCTGAGACCTACTGGG + Intronic
1190465470 X:50721664-50721686 AAATGAGGCTGAGACCTGCTGGG - Intronic
1191004853 X:55700467-55700489 AAATAAGGCTGAGACCTACTGGG - Intergenic
1191006030 X:55712337-55712359 GAATAAGGCTGAGACCTGCTGGG - Intergenic
1191617123 X:63181398-63181420 GGGTAAAACTGAGAGCTGCTGGG + Intergenic
1191619175 X:63197525-63197547 GGGTAAAACTGAGAGCTGCTGGG - Intergenic
1191636822 X:63387570-63387592 AAATAAGGCTGAGACCTACTGGG + Intergenic
1191822872 X:65332071-65332093 AAATAAGGCTGAGACCTACTGGG - Intergenic
1192031846 X:67522305-67522327 AAATAAGGCTGAGACCTACTGGG - Intergenic
1192498255 X:71630956-71630978 AAATAAGGCTAAGACCTGCTGGG + Intergenic
1192542247 X:71983993-71984015 AAATAAGGATGAGACCTGCTGGG - Intergenic
1192864488 X:75116715-75116737 AAATAAGGCTGAGACGTGCTGGG + Intronic
1192865055 X:75122086-75122108 AAATAAGGCAGAGACCTGCTGGG + Intronic
1193903808 X:87218068-87218090 AAATAAGGCTGAGACCTACTGGG - Intergenic
1194997743 X:100610390-100610412 AAATAAGGCTAAGACCTGCTGGG + Intergenic
1195117084 X:101710264-101710286 AAATAAGGCTGAGACCTACTGGG + Intergenic
1197164903 X:123366233-123366255 AAATAAGGCTGAGACCTACTGGG - Intronic
1197198976 X:123732663-123732685 AGGGAGCGCGGAGACCTGCAGGG + Intronic
1198454746 X:136805493-136805515 AAATAAGGCTGAGACCTACTGGG + Intergenic
1198832938 X:140770166-140770188 AAATAAGGCTGAGACCTACTGGG + Intergenic
1198847017 X:140923266-140923288 AAGTGAGGCTGAGACCTACTGGG - Intergenic
1198966546 X:142233116-142233138 AAATAAGGCTGAGACCTACTGGG - Intergenic
1199394806 X:147323322-147323344 AAATAAGGCTGAGACCTGCTGGG + Intergenic
1199404550 X:147441955-147441977 AAATAAGGCTGAGACCTACTGGG + Intergenic
1199545308 X:149002498-149002520 AAATAAGGCTGAGACCTACTGGG + Intergenic
1200384762 X:155879599-155879621 AAATAAGGCTGAGACCTACTGGG - Intergenic
1200785756 Y:7259076-7259098 AAATAAGGCTGAGACCTACTGGG + Intergenic
1201288058 Y:12395832-12395854 ACATGAGGCTGAGACCTGCTGGG + Intergenic
1201973930 Y:19828176-19828198 CAATAAGGCTGAGACCTGCTAGG + Intergenic
1202302157 Y:23428201-23428223 AAATAAGGCTGAGACCTACTGGG - Intergenic
1202568654 Y:26242397-26242419 AAATAAGGCTGAGACCTACTGGG + Intergenic