ID: 1171365503

View in Genome Browser
Species Human (GRCh38)
Location 20:24620271-24620293
Sequence TTCAAGAAGCAGCATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 2, 2: 2, 3: 32, 4: 342}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171365503 Original CRISPR TTCAAGAAGCAGCATGAGGA TGG Intronic
900547125 1:3235434-3235456 TTCCGGAAGCAGAAGGAGGAAGG + Intronic
900926487 1:5709420-5709442 GGCAAGAAGCAGCAAGAGAAGGG - Intergenic
901434842 1:9241018-9241040 GTCTGGAAGCAGCAGGAGGAAGG - Intronic
901536068 1:9883670-9883692 TTCCAGGAGGACCATGAGGAGGG - Intronic
902586384 1:17440951-17440973 TTCAAGAAGTTGCCTGAAGAAGG - Intergenic
902587056 1:17446190-17446212 TTCAAAAGGCAGCAGGAGGCCGG - Intergenic
903287911 1:22288416-22288438 GTCAAGAAGGAGCGTGTGGAAGG + Intergenic
904111190 1:28127886-28127908 TTAAAGAGACAGCCTGAGGAAGG - Intergenic
906036940 1:42756462-42756484 TCCAAGCAGCAGGAGGAGGAAGG + Intronic
906280420 1:44549640-44549662 GTTAAGAAGCAGCAGGAGGAAGG - Intronic
906815738 1:48876408-48876430 ATCAAGAGGCAGCGAGAGGAAGG + Intronic
907433559 1:54429422-54429444 CTCGGGAAGCTGCATGAGGAGGG + Intergenic
907570108 1:55475598-55475620 TCCAAGAAACAGCATGGGTAAGG + Intergenic
908885346 1:68781923-68781945 TTTATTAAGCAGCATGAGAACGG + Intergenic
911853185 1:102844001-102844023 TCCAAGAAGCAGCAAGAGAATGG + Intergenic
913130307 1:115833129-115833151 GTCTAGAAGCAGCGTGAGAATGG + Intergenic
913334308 1:117694821-117694843 TTCAAGAGGAAGAATAAGGAAGG + Intergenic
914668037 1:149848496-149848518 TTCAAGAGGCAGCAGGAGGATGG - Intronic
914750668 1:150532876-150532898 TCCAAGAAGCAGCATTAGAAAGG - Intergenic
917753039 1:178071684-178071706 TTCAAGGAGCTGCGTCAGGATGG + Intergenic
919548448 1:198953234-198953256 TTAAAGAAGGAGAATGAGGAAGG - Intergenic
919837404 1:201584651-201584673 TTCTAGAAACAGACTGAGGAGGG - Intergenic
920642371 1:207764903-207764925 TTCAAGAAAGTGCAAGAGGAGGG + Intronic
921681714 1:218041068-218041090 TTCAAGATGGAGCTTGAAGATGG + Intergenic
922308080 1:224361879-224361901 CTCAAGAAGCTACATGAGGCTGG - Intronic
922621053 1:226988424-226988446 GTCAAGCAGCAGCATGCGGGGGG + Intergenic
923352710 1:233125314-233125336 TTTAAGAAGCAGGTAGAGGAAGG - Intronic
923445933 1:234071334-234071356 TAAAAGAAGCACCATGATGATGG - Intronic
923626164 1:235615732-235615754 TCCAAGAAGCACCAGGAGGAGGG + Intronic
1062815234 10:494632-494654 GTCAATATGCAGCATGAGAAAGG + Intronic
1063057057 10:2517069-2517091 TACAAGAAGCAGGATAAGGAAGG - Intergenic
1064054046 10:12082409-12082431 TTCAAAAAGTAACATGAGGTAGG - Intronic
1065144515 10:22754759-22754781 TTCAAGAAGCCACATTAGAAGGG - Intergenic
1065301272 10:24323509-24323531 TTCAATAAAGAGCATGAGTAGGG - Intronic
1067044869 10:42979899-42979921 TGTGAGAAGCAGCATGAGGAGGG + Intergenic
1068531060 10:58187125-58187147 TTCAAGAGACACCATGAAGATGG + Intergenic
1072033470 10:91542823-91542845 TTTAAGAAGCAGAATGTGGCCGG + Intergenic
1073522156 10:104142753-104142775 GTCAAGAAGCAACAAGAGGAAGG + Intronic
1073660422 10:105470067-105470089 TTCAAGAGACAGCAAAAGGAAGG - Intergenic
1074559069 10:114519115-114519137 TTCAAGAGGCAGCCTGGGGGAGG + Intronic
1075136194 10:119788333-119788355 TTCTAGATGGAGCATGAAGACGG + Intronic
1075295076 10:121267948-121267970 TGCTAGAAGCAGGATGATGAAGG + Intergenic
1075686133 10:124366612-124366634 TTCAAGGAGCAGGGAGAGGAAGG + Intergenic
1076890122 10:133279235-133279257 TTGGAGCAGCAGCAGGAGGAGGG + Exonic
1078313486 11:10270695-10270717 TTTAAGAAGTAAAATGAGGACGG + Intronic
1078777874 11:14410368-14410390 TTCAAGAAATAGCAAGATGATGG + Intergenic
1079339429 11:19599777-19599799 TTTGAGAAACAGCATGAGGGAGG + Intronic
1079395297 11:20057095-20057117 TTGAAAAAGCAGAATGTGGAGGG + Intronic
1079451857 11:20604917-20604939 TTCAAGAAGCAGAAGAAGGCGGG - Intronic
1079505890 11:21151337-21151359 TTCATAAAGCAGCATGAAGGTGG + Intronic
1080683554 11:34497055-34497077 TTGAAGAATCAGAAAGAGGATGG + Intronic
1081373815 11:42336079-42336101 TTCATGAAGAAGCATAAGGAAGG - Intergenic
1083495489 11:63048410-63048432 TTCAAGGAGAAGCATAAAGAGGG - Intergenic
1083631045 11:64095709-64095731 TTCTAGATGCAGCAGGCGGAGGG + Intronic
1084314137 11:68334251-68334273 ATAAAGAAGCAGCATGTCGAGGG + Intronic
1086555430 11:88104913-88104935 TCCCAGAAGCAGCATGAGAAGGG - Intergenic
1086759950 11:90616208-90616230 ATGAAGAAGCAGCATGAACATGG - Intergenic
1087193251 11:95278774-95278796 TGAGAGAAGCAGAATGAGGAGGG + Intergenic
1088006156 11:104943034-104943056 TGCAAGAAGAATCATGATGAGGG - Intronic
1088049562 11:105495038-105495060 GTCAGGAGGCAGCATGAAGATGG - Intergenic
1088434181 11:109792551-109792573 TACTAGTAGCAGTATGAGGAGGG + Intergenic
1088712673 11:112522824-112522846 TTCCAGAAGCAGAATGGAGAAGG + Intergenic
1088899741 11:114106337-114106359 TTTAAGAAGCATCATTATGATGG + Intronic
1089085428 11:115813097-115813119 TTCAGGAAGCAGCAAAAGGTTGG - Intergenic
1089430150 11:118416864-118416886 TACAAGAAGCATCAACAGGAGGG + Intronic
1089688137 11:120169802-120169824 TTCCAGATCCATCATGAGGATGG - Exonic
1091334365 11:134755324-134755346 GTCCAGATGCAGCATGAGCAGGG - Intergenic
1092099432 12:5871025-5871047 TTAAAAAAGCAACTTGAGGAAGG + Intronic
1092337151 12:7643244-7643266 TTCAAATGGCAGCATGAGCATGG - Intergenic
1092656973 12:10696162-10696184 TTGAAGAAGTTGCAAGAGGAAGG - Intergenic
1094098063 12:26730328-26730350 GTTTAGAAGCAGGATGAGGAGGG - Intronic
1094317884 12:29151947-29151969 TTTCAGAAGTAGCTTGAGGAAGG + Intronic
1094521765 12:31198513-31198535 TTCAAAAAGAAGCATGATGCTGG + Intergenic
1094535683 12:31320816-31320838 TTCAAGCAGGAGCAGGGGGAAGG + Intronic
1100935634 12:99661899-99661921 TTCAATCAGCAGGAAGAGGAAGG - Intronic
1101929974 12:109005942-109005964 TTCAAGTAGCAGCAAGAGGGTGG + Intronic
1103988853 12:124785034-124785056 CTCCAGAAGCAGCAGGAAGAGGG - Intronic
1104022853 12:125005321-125005343 TCCAAGAAAAAGCATGAGGTGGG - Intronic
1104901548 12:132191980-132192002 TACAGGAAGCAGCATGCGGGGGG - Intergenic
1105899394 13:24742541-24742563 TTCAAGAAGCAGCAAGAGGGAGG - Intergenic
1106773729 13:32987794-32987816 TTCATGTAGCAGCATTAAGAGGG - Intergenic
1107626008 13:42284867-42284889 TTGAAGCAGCAGCATGAGAAAGG - Intronic
1109443579 13:62405519-62405541 CTCAGGAAGCAACAGGAGGAGGG - Intergenic
1110048815 13:70867662-70867684 TGTAAGAATCAGCATAAGGATGG - Intergenic
1110177120 13:72570122-72570144 TTTAAGAAGCAGGGTGAGGTTGG - Intergenic
1110659415 13:78041864-78041886 TTTAAGAATCAGCAGGAGGCTGG - Intergenic
1111655439 13:91146201-91146223 TTCAAGAATCTGCTTGAGGCTGG + Intergenic
1111968008 13:94880651-94880673 ATCAAGAAGCCACATGAGGCAGG + Intergenic
1112725707 13:102302062-102302084 TTGAACAAGCAGTGTGAGGAAGG - Intronic
1113110650 13:106819683-106819705 TTCAAGGATCAGAGTGAGGAAGG + Intergenic
1115023219 14:28708418-28708440 TTGCAGAAGAAGCATGTGGATGG + Intergenic
1115753259 14:36510729-36510751 TTAGAGCAGCAGCATTAGGAGGG + Intronic
1116120416 14:40716576-40716598 TTTATGAAGCAGCATGAAAATGG + Intergenic
1116726036 14:48562390-48562412 TTCAAACAGCAGAAAGAGGATGG + Intergenic
1116862455 14:50005525-50005547 TTAAATAAGCAGCAGGAAGAAGG + Intronic
1117313083 14:54547884-54547906 TTAAAGAACCAGGCTGAGGAAGG - Intergenic
1118101788 14:62614082-62614104 TCCAGGAACCAGCAGGAGGAAGG + Intergenic
1119220162 14:72900144-72900166 TTCCAGCAGCAGCATGACCATGG + Intergenic
1119226089 14:72945651-72945673 TTCAAGAGGAAGGATGAGAATGG - Intronic
1119543752 14:75457279-75457301 TTCAAGAAGCACCAGGAAGGAGG + Intronic
1121109805 14:91304338-91304360 TTCAGGAAGCAGAAGCAGGAGGG + Intronic
1121534559 14:94682231-94682253 TTCAAGAAGCTGTTTGAAGAAGG + Intergenic
1123000977 14:105293971-105293993 TTCAAGATGAAGCTGGAGGAAGG + Intronic
1123974879 15:25543743-25543765 TCAAAGAAGGACCATGAGGAAGG - Intergenic
1126181217 15:45787069-45787091 TTTAATAAGCAACAAGAGGAGGG - Intergenic
1126249857 15:46554832-46554854 TTCTTATAGCAGCATGAGGATGG - Intergenic
1127143910 15:56005604-56005626 GTGAAGAAGCAGCTTAAGGATGG + Intergenic
1127806763 15:62528376-62528398 TACAAGGAGAAGCAAGAGGAAGG + Intronic
1128109101 15:65065275-65065297 TGCAAGAAGCAGAAAGAGGTTGG + Intronic
1128554657 15:68623270-68623292 TTCAAGAGGCAGCATGGGCCCGG - Intronic
1128825491 15:70712077-70712099 CTCAAGAAGAATCATGAAGAAGG - Intronic
1128884709 15:71275967-71275989 TTCTATCAGCAGCATGAGAACGG + Intronic
1135196583 16:20399732-20399754 TTCAAGCAGGAGCTGGAGGAGGG - Intronic
1136249311 16:28993515-28993537 TACAATAATCAGAATGAGGACGG - Intergenic
1136679390 16:31947390-31947412 TTTAAAAAGCAGCAAGAGAAAGG + Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1138594940 16:58024914-58024936 TTCCGGAAGCAGCTTGAGGTCGG - Intergenic
1140625708 16:76791965-76791987 ATCAGGTAGCAGCATGTGGAAGG + Intergenic
1141143689 16:81514339-81514361 TTCCAGAAGTGGCATGAGGAGGG + Intronic
1141560785 16:84866530-84866552 TTCAAGAAGCTGCCTCAGGCCGG - Intronic
1142571497 17:877842-877864 TCCAAGAAACAGCAAGAGGCAGG + Intronic
1144725592 17:17500451-17500473 TTCAAGAAGAAGCAGGAGGGAGG - Intergenic
1148653654 17:49267584-49267606 TGCAAGAGGAAGGATGAGGAAGG + Intergenic
1149841434 17:59968410-59968432 TTCAAGAAGAAGAATGAGATTGG + Intronic
1150417264 17:64997565-64997587 TTCAAGATGAAGAGTGAGGAGGG - Intergenic
1150515471 17:65805320-65805342 TACAACAAGTAGCATGAGCAAGG - Intronic
1151972965 17:77468346-77468368 TTCTAGGAACAGCATGGGGAAGG + Intronic
1152920300 17:83063219-83063241 CCCAAGCAGCAGCTTGAGGAGGG + Intergenic
1153851180 18:9096136-9096158 TTTAAGAAGCAGCCTGAGGGAGG + Intergenic
1154299099 18:13177150-13177172 TTCCACGAGGAGCATGAGGAAGG + Intergenic
1154338667 18:13485518-13485540 AGCCACAAGCAGCATGAGGATGG - Intronic
1155328112 18:24686389-24686411 TGCAAGAAGCAGCAGGTGCAGGG + Intergenic
1156045987 18:32877920-32877942 TTCAAAAAGTAGCATGATGAAGG - Intergenic
1156331322 18:36126593-36126615 TACCAGAAGCAGCATGATTATGG + Exonic
1157983022 18:52404433-52404455 TTCACTATGCAGCAGGAGGAAGG - Intronic
1158001848 18:52628708-52628730 TGCAGGTAGCAGCATGAGTAGGG + Intronic
1158549393 18:58422319-58422341 TTCTGGAAGAAGAATGAGGAAGG - Intergenic
1158673038 18:59494062-59494084 CTCAGGAAGCAGCATGAAAATGG + Intronic
1159304754 18:66626299-66626321 TTCATAAAGCAACATGAGAATGG + Intergenic
1160445369 18:78923164-78923186 TTCAGGAAGCAGCGGGAGAATGG + Intergenic
1160619851 18:80163177-80163199 CTCAAGGAGGAGCATGTGGATGG - Intronic
1163384233 19:16989580-16989602 TCCAAAAAGCAGCATGAGCCAGG - Intronic
1163912233 19:20206520-20206542 TTGAAGAAGTAGAATCAGGAAGG + Intergenic
1164754987 19:30682625-30682647 TCCAGGAAGCAGCGTCAGGAGGG - Intronic
1165975660 19:39674222-39674244 TTTAAATAGCAGCATGAGCATGG - Intergenic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1168579425 19:57541638-57541660 TTAAAGATGAAGCATGAGAACGG - Intronic
924989703 2:302123-302145 GTGAAGAAGCTGCATAAGGAAGG + Intergenic
925852963 2:8101040-8101062 TTGAAGAAGCAGAAAGAGCAAGG - Intergenic
926277127 2:11412752-11412774 TTCCTGAAGCTCCATGAGGATGG - Intergenic
926599455 2:14826072-14826094 TTCAAGAGGCTAAATGAGGAGGG + Intergenic
927202090 2:20584187-20584209 TTCTAGAAGCAGCACCAGGAAGG - Intronic
927300900 2:21513075-21513097 TTCAAAAAGAAAAATGAGGAGGG - Intergenic
927527265 2:23756610-23756632 TTTAAGAAGCAGCAGAAAGAGGG - Intronic
927876059 2:26655856-26655878 TTTAAGAAACAGCAAAAGGAAGG - Intergenic
928268836 2:29836094-29836116 TGCAGGAAGCAGGATGGGGAAGG - Intronic
928611082 2:32993123-32993145 TGGAAAATGCAGCATGAGGAGGG + Intronic
928785543 2:34881207-34881229 TTAAAGAAGGAGCAAAAGGAAGG - Intergenic
929198812 2:39213569-39213591 TTCAAGGAACACCATGCGGAAGG + Intronic
929324770 2:40595950-40595972 TTCAGGAATTAGAATGAGGAAGG + Intronic
929396070 2:41523751-41523773 TTCAAGAGGCAGCATAAAGAGGG + Intergenic
933386004 2:81610982-81611004 CTCAAAAAGCAGCAGGAAGAAGG + Intergenic
933479829 2:82841606-82841628 TACAAGAAGCAGCAACATGAAGG - Intergenic
933633592 2:84682884-84682906 TGCTAGAAGCAGCCTCAGGAGGG - Intronic
934695348 2:96396176-96396198 TTCAAGGAGCACAATGAGGGGGG + Intergenic
935265647 2:101391639-101391661 TATAAGAAGCAGCATCAGGCTGG + Intergenic
936006865 2:108896906-108896928 TTCAGGATGCAGCATGTGGCTGG + Exonic
936111924 2:109671570-109671592 TTCAGGCACCAGCAGGAGGAGGG - Intergenic
936469238 2:112783846-112783868 TTCAGGAAGCACAAAGAGGAGGG - Intronic
936703072 2:115037105-115037127 TTCAGGGAGCAGCATATGGAGGG + Intronic
937556960 2:123170045-123170067 TCCAAGAAACATCATGAGAAAGG + Intergenic
939113658 2:138036635-138036657 TTCAAGAAGAAAGATGAGTACGG - Intergenic
939269287 2:139916989-139917011 ATCAAGAAACAGCATTAGGTGGG - Intergenic
939318587 2:140585398-140585420 TTCAGGAAGCAGTATGATGTGGG - Intronic
939904218 2:147890869-147890891 TTGCAGAATCAGCTTGAGGAGGG + Intronic
942773791 2:179555989-179556011 TCAAAGAAGCCGCATCAGGAGGG + Intronic
942942183 2:181631516-181631538 TGCAAAAAGCAGCATTAGCATGG - Intronic
943407231 2:187505227-187505249 TTCAGGAAGCAGGCTGAGGTTGG + Intronic
943458252 2:188135559-188135581 TTAATGCAGCAGCAAGAGGAGGG - Intergenic
946311037 2:218882801-218882823 ACCCAGAATCAGCATGAGGAGGG + Intronic
946508893 2:220333292-220333314 TTCTAAAAGCAGCAAGAGAAAGG - Intergenic
947542808 2:230990444-230990466 CTCTGGAAGCAGGATGAGGACGG + Intergenic
948664135 2:239523954-239523976 TTCCAGAAGCAGAATGAGGTTGG + Intergenic
1168822763 20:786830-786852 TTCAAACAGCAGAAAGAGGATGG - Intergenic
1169009684 20:2239808-2239830 TTCAATAAAGAGAATGAGGAAGG - Intergenic
1169200706 20:3707891-3707913 TTCAAGGAGCAGCATGAATTTGG + Intergenic
1169419230 20:5445993-5446015 TTCAAGAGGCTGCTTGGGGAGGG - Intergenic
1170404863 20:16025595-16025617 TTCAGGAAGCCGCCTGGGGATGG + Intronic
1170405234 20:16028799-16028821 GTCAAGTAGCAGCTTTAGGATGG + Intronic
1170792778 20:19521504-19521526 TTCTTGAAGGAGCATGAGGCTGG + Intronic
1170978852 20:21192053-21192075 TCCAAGGAGCAGGATCAGGACGG + Intronic
1171148978 20:22810315-22810337 TTCAAGAAGGGGCAGGAGGGCGG + Intergenic
1171365503 20:24620271-24620293 TTCAAGAAGCAGCATGAGGATGG + Intronic
1171425787 20:25047707-25047729 TACAGGAAGCAGCTTGGGGAAGG + Intronic
1172624829 20:36340974-36340996 TTCCAGGAGGAGCATGGGGAGGG - Intronic
1172699272 20:36843021-36843043 TCCCAGTGGCAGCATGAGGAGGG - Intronic
1173314031 20:41927562-41927584 TTCAGGAAGCAGCAGGCTGATGG - Intergenic
1173496948 20:43526352-43526374 GGCAAGAAGCAGCAGGATGATGG + Intronic
1173674511 20:44822128-44822150 TTCAAGAAACAAAACGAGGAGGG - Intergenic
1175879575 20:62249467-62249489 TTTAAGAAAAAGCATTAGGAAGG - Intronic
1175927744 20:62479337-62479359 TTCAGGAAGCAGCATGGGCGGGG - Intergenic
1177549945 21:22607685-22607707 TTAAAAAAGCAACATGAGGCCGG + Intergenic
1177667352 21:24177967-24177989 TTCATAAAGCAGCATCAGCATGG - Intergenic
1178511935 21:33212668-33212690 AACAAGAAGCAGCATGCTGAGGG - Intergenic
1179972930 21:44846200-44846222 TTCAGGGACCTGCATGAGGAAGG - Intergenic
1180857556 22:19058003-19058025 TCCAAGAAGCAGAATAATGAAGG + Intronic
1180887584 22:19258155-19258177 TTCATGAAGAACCATGAAGAGGG + Intronic
1182522471 22:30892183-30892205 TTAGAGGAGGAGCATGAGGAGGG + Intronic
1183176084 22:36225689-36225711 TGGAAGAAGGATCATGAGGAAGG + Intergenic
1183182249 22:36268024-36268046 TGGAAGAAGGATCATGAGGAAGG - Intergenic
1183466647 22:37983603-37983625 GTCAAGAAGGAGCAGCAGGACGG - Exonic
1184302598 22:43570993-43571015 TTAACAAAGCAGTATGAGGAAGG + Intronic
1184515199 22:44957457-44957479 CTCTGGAGGCAGCATGAGGACGG - Intronic
949869922 3:8579879-8579901 TGCAAGAATCAGCAGGAAGAGGG + Intergenic
950194408 3:10999004-10999026 TTTCAGAAGCAGCATGAGGTTGG - Intronic
950484435 3:13264698-13264720 TTCAACAAGCGGGAGGAGGACGG + Intergenic
950623184 3:14224366-14224388 TGAAAGAAGCAGTATCAGGAGGG + Intergenic
950841750 3:15974635-15974657 GTCAAGGAGCACCATGAGGCTGG + Intergenic
950879705 3:16313337-16313359 TTCAAGATGGACCATGAGGCTGG - Intronic
950895820 3:16449934-16449956 ACCAGGAAGCAGCAGGAGGAGGG + Intronic
950933893 3:16819217-16819239 TTCAGGAAGAAGCATGAGGGAGG - Intronic
951738469 3:25894194-25894216 TCCAAGGAGCAGAAAGAGGAAGG + Intergenic
952764577 3:36943859-36943881 TTTAAGAAGCAGAAAGAGAATGG - Intronic
953435561 3:42874731-42874753 TTCATGAACCAACCTGAGGAGGG + Exonic
953600771 3:44361954-44361976 TTTTAGAAGCAGCATAAGGTTGG - Intronic
954078265 3:48196827-48196849 TTCAAGAAACAGCAGGAGGGAGG + Intergenic
954994507 3:54869355-54869377 TTAAAGAAGCAGAATTAAGAAGG + Intronic
955496096 3:59534218-59534240 TTCAAGATGCTGCATGAAGAAGG + Intergenic
955994406 3:64664870-64664892 TTCAAGAAGAAGCAAGAAAATGG - Intronic
958824813 3:99017527-99017549 ATCATCAAGCAGGATGAGGAGGG - Intergenic
961935986 3:130584444-130584466 TTCTAGAATGAGAATGAGGAGGG - Intronic
965558045 3:170037763-170037785 CTCAAGATGTGGCATGAGGAAGG + Intergenic
965610845 3:170542474-170542496 TGCAAGAGGCAGAATGGGGAAGG - Intronic
965819783 3:172673519-172673541 TTCAAATGGCAGCATGAGCATGG - Intronic
966329590 3:178795555-178795577 TACCAGAAGAAGCCTGAGGAGGG - Intronic
966420682 3:179731633-179731655 TACAACAAGCAGCATAGGGAGGG - Intronic
966706002 3:182914651-182914673 TTCAAGAAACAGATTTAGGAGGG - Intronic
967295097 3:187956696-187956718 TTGAAGAAGCACCTTGAAGATGG - Intergenic
968611870 4:1560904-1560926 GCCGAGAGGCAGCATGAGGAGGG + Intergenic
969307979 4:6336499-6336521 TTCAGGAAGGGGCAGGAGGAGGG + Intronic
970497711 4:16643980-16644002 CTCAAGAAGCAGCACTTGGAAGG - Intronic
971577401 4:28293226-28293248 TTGAAGAAGCAGAAAGATGAAGG + Intergenic
972423247 4:38909915-38909937 TTCAAGGAGCAGCAGGGTGATGG - Intronic
973062632 4:45747637-45747659 TTCCAGAAACAGCATAAAGATGG - Intergenic
973919607 4:55671897-55671919 TTCTAAAAGCAGCAAGAGAAAGG - Intergenic
974981034 4:68957108-68957130 TTCCTGGAGCAGCATGAAGATGG - Intergenic
975584342 4:75935787-75935809 TTCCAGAAGCAGCCTGGGCATGG + Intronic
975770791 4:77720325-77720347 CTGAAGAAGCAGCTTAAGGATGG + Exonic
976036964 4:80835342-80835364 TTCAAGAAGCAGGCCGAGGCGGG - Intronic
976703385 4:87995510-87995532 ATCAAGAAACAGGAGGAGGAGGG + Intergenic
978383909 4:108160978-108161000 TTCAAGAAGCAGGATGCCAAGGG + Intronic
980680493 4:136153881-136153903 TCAAAGAAGCAGCTTTAGGAAGG - Intergenic
981330256 4:143500002-143500024 TTCAAGCACCAGAATGAGAAGGG - Intergenic
981357029 4:143800562-143800584 TTCAAAGAGCAGCATGAGTGAGG + Intergenic
982474983 4:155839403-155839425 TTCCAGAAGTAGGATGGGGAGGG + Intronic
983375525 4:166922623-166922645 TTAGAGAAACAGCATAAGGAAGG - Intronic
984547809 4:181128344-181128366 TTGAAGATGCAGGATGGGGAAGG + Intergenic
984556712 4:181222932-181222954 TTCAGCAAGCAGAATGTGGATGG + Intergenic
985145056 4:186887920-186887942 CTTAGGAAGCAGCATGAGAAGGG + Intergenic
985870895 5:2555992-2556014 TTTAAAAAGCAGAATGAGAATGG - Intergenic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
987445397 5:18011510-18011532 GGAAAGAAGCAGCATGAAGAAGG + Intergenic
988095046 5:26596044-26596066 TGCCAGAAGAAGCAAGAGGAAGG - Intergenic
990035540 5:51313598-51313620 TTCAAGCAGCACCATGAACATGG - Intergenic
990529505 5:56659778-56659800 TCCAAGAAGCACCCTGAGAATGG - Intergenic
990867362 5:60395075-60395097 ATTAAGATGGAGCATGAGGAAGG - Intronic
991618465 5:68520538-68520560 GTCAAGAAGGAGCACCAGGACGG + Intergenic
994312251 5:98287132-98287154 TTCAAGAAGGAACATCAAGAAGG + Intergenic
994658578 5:102625915-102625937 TTCAACAACCATCATGAGCAAGG + Intergenic
995082513 5:108069802-108069824 TTCAGGCATCTGCATGAGGAAGG - Intronic
996956582 5:129189791-129189813 TCCTAAAAGCAGCATGAGAAAGG + Intergenic
997506599 5:134422729-134422751 TTGAGAAAGCAGCAAGAGGAAGG + Intergenic
998163758 5:139828658-139828680 TTTCAGAAGCAGGATGAGGCAGG - Intronic
999530977 5:152463454-152463476 TTCAAGAAGCAGACAGGGGAGGG - Intergenic
1000058759 5:157633950-157633972 TGCAAGAAGAAGGAAGAGGAAGG + Intronic
1001008048 5:168072392-168072414 ATCAAAAGGCAGCATGATGAGGG + Intronic
1001735887 5:174000765-174000787 TTTAAGAAGGAGAATGAGGTGGG + Intronic
1002093721 5:176818810-176818832 GTCAGGAGGCAGCATGGGGATGG - Intronic
1002173679 5:177389372-177389394 CACAAGAAGCAGCAAGGGGAAGG - Intronic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1002755815 6:158542-158564 TTCCATAGTCAGCATGAGGATGG - Intergenic
1003115856 6:3283625-3283647 TCCAGGCAGCAGCAGGAGGAAGG - Intronic
1005725956 6:28648990-28649012 TTGAAGAACCAAAATGAGGAAGG - Intergenic
1006289056 6:33120394-33120416 TTTAAATAGCAGCATGAGCATGG + Intergenic
1006377138 6:33677857-33677879 GTCAAGAATCAGCATAAGGCTGG - Intronic
1006469931 6:34223059-34223081 TTGAAGAAGCAGGATGATGATGG + Intergenic
1006748642 6:36362920-36362942 TCCAAGATGAAGCAGGAGGATGG - Intronic
1007618487 6:43196803-43196825 ATTGAGAAGCATCATGAGGATGG - Exonic
1008313690 6:50011724-50011746 TTCCAGGAGCATCATGAGGTAGG - Intronic
1008456344 6:51715322-51715344 TTCAGGAAGAAGCATAATGAAGG - Intronic
1010505068 6:76646998-76647020 TACCAGAAGCAGCCTGAGGGAGG - Intergenic
1011115142 6:83881471-83881493 TACAAGAAGCAGTATGAGGCTGG - Intronic
1011501904 6:87999858-87999880 ATGAAAAAGCAGCAAGAGGATGG + Intergenic
1012443733 6:99287738-99287760 CTCAAGAAGTAACATGAGAAGGG - Intronic
1014139641 6:117926410-117926432 TTTTCGTAGCAGCATGAGGATGG + Intronic
1014806650 6:125837730-125837752 CTTAGGAGGCAGCATGAGGAAGG + Intronic
1016779582 6:147943415-147943437 TTCAAGAAGCAGATTGGGGTGGG - Intergenic
1017868931 6:158469812-158469834 TTTAACAAGCAGCAGAAGGAAGG + Intronic
1017909726 6:158782473-158782495 TTCAAGGAACAGCATGAGGCTGG + Intronic
1018258276 6:161943972-161943994 CTGAGGAAGCAGCCTGAGGAAGG + Intronic
1019307706 7:343790-343812 TTCAGGAAGCGCCATGAGGCCGG + Intergenic
1019739536 7:2665842-2665864 TTCCAGAAGCAGCATGGAGGCGG + Intergenic
1020026719 7:4904847-4904869 TGCAAGTAGCTGCATGATGAAGG + Intergenic
1022084792 7:27056467-27056489 TTTAAGAAGCTGCATGGGGATGG - Intergenic
1022818700 7:33937926-33937948 TTCCAGAAGGAGCATGTGGCTGG - Intronic
1023053737 7:36275206-36275228 TCCAGGAAGCAGGATGAGGATGG + Intronic
1024368869 7:48557599-48557621 TTCTAAAAGCAGCAAGAGAAAGG - Intronic
1026211645 7:68311228-68311250 TTCATAATGCAGGATGAGGATGG - Intergenic
1027744478 7:82056335-82056357 TTGGAGAAGCAACATGAGGATGG + Intronic
1029009910 7:97248853-97248875 TGAAAGCAGCAGTATGAGGAAGG + Intergenic
1030184762 7:106750739-106750761 TTGCAGAAGCAGCAGAAGGAGGG - Intergenic
1030692391 7:112548973-112548995 TTCAGAAAGCAGCAAGAGCAAGG - Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1032172954 7:129600942-129600964 TTCAAGAGGCAGCAGGATGAAGG - Intergenic
1032236842 7:130131980-130132002 TTTAAAAACTAGCATGAGGAAGG + Exonic
1032699095 7:134363163-134363185 TTGAATAAGCAGCATGAGAAGGG - Intergenic
1033266276 7:139889944-139889966 ATCAGGAAGCTGCATTAGGAAGG + Intronic
1033451139 7:141463273-141463295 TTCCAGAACCAGCAGGAAGAGGG + Intronic
1035257157 7:157637737-157637759 TTTCAGAAGAAGGATGAGGAGGG + Intronic
1035412047 7:158652300-158652322 TTCAGGAAGCAGCCGGAAGAAGG - Exonic
1037862492 8:22415811-22415833 TCCAAGAAGGACCAGGAGGAGGG + Exonic
1037871925 8:22506138-22506160 TTTAAAAAGCAGCATGAGCCAGG + Intronic
1038679816 8:29656327-29656349 TTCAAGGAGGAGGATGAGGCAGG - Intergenic
1038959126 8:32499200-32499222 TTCAGGAAGCAGCATGCAGGTGG + Intronic
1040683873 8:49847053-49847075 TTCAAGAAGCTGAAATAGGAAGG - Intergenic
1041283086 8:56231245-56231267 TTCAAGAACCAGCATCTGTATGG + Intergenic
1041778183 8:61547512-61547534 TTCCAGAAGCTACATGAGGTAGG + Intronic
1043745834 8:83872284-83872306 TAGAAGAAGCAGCTTTAGGACGG - Intergenic
1043934768 8:86130739-86130761 TTCAAGTAGCAGCAGGAAGGAGG - Intronic
1044675517 8:94724468-94724490 TTAAAGAGGCATAATGAGGAAGG + Intronic
1045774141 8:105781830-105781852 TTTATGAAGCAGCATTAGGCAGG - Intronic
1046156759 8:110301336-110301358 TTCAAAAAGCAGAAAGAGGCCGG + Intergenic
1046786330 8:118271103-118271125 ATCAATTAGCAGCATGAGAATGG - Intronic
1048259052 8:132930274-132930296 GTGAGGAATCAGCATGAGGATGG + Intronic
1048676168 8:136783623-136783645 TACAAAAAGCAGCATGAAGCTGG - Intergenic
1049062570 8:140287311-140287333 AGCAAGAAGGAGCAGGAGGAAGG + Intronic
1049186902 8:141260022-141260044 CTCATGAAACAGCATGAGCATGG + Intronic
1049274355 8:141712230-141712252 CTCAGGAAACAACATGAGGACGG - Intergenic
1049508581 8:143016608-143016630 TTCAATGAGCAGCCTGAGGTTGG - Intergenic
1052129474 9:24824838-24824860 TTCAAGTAACAGCAAGAGAAAGG - Intergenic
1052843407 9:33313158-33313180 TCCATGAAGCAGCATGCGTAAGG - Intronic
1053164049 9:35832302-35832324 GTCCAGAAGAAGCATGAGTAAGG - Intronic
1055209901 9:73779225-73779247 TTCACCAGGCAGCAGGAGGAGGG - Intergenic
1055238851 9:74159309-74159331 GTCAAAAAGGAGCAAGAGGAGGG + Intergenic
1055460905 9:76519391-76519413 TTCTAGAAACTGCATGAGGGAGG + Intergenic
1056110792 9:83392533-83392555 TTCAGGAGGAAGCATGTGGAAGG - Intronic
1056469780 9:86894207-86894229 AGCAAAAAGAAGCATGAGGAAGG - Intergenic
1057419107 9:94895075-94895097 ATCAAAAGGCAGCATGAGGCTGG + Intronic
1057513061 9:95697017-95697039 TGCAAAAAGCAGCAGGTGGAGGG + Intergenic
1058342287 9:103913078-103913100 TTCTAGATGCAGCAATAGGAGGG - Intergenic
1058700645 9:107597431-107597453 TAAAAGAAGCAGCAGGATGAAGG - Intergenic
1059820948 9:117971392-117971414 GTCAAGAAGCACCATGTGGAGGG + Intergenic
1062664030 9:137657206-137657228 TTGAGGAAGCAGCAGGAGCAAGG + Intronic
1186930904 X:14388923-14388945 TTATAGCAGCAGTATGAGGAAGG - Intergenic
1188318789 X:28709653-28709675 TTCAAGCAGCAGCTTGAAGGTGG + Intronic
1188353053 X:29155580-29155602 TTCAAAAATCAGCATAAGAAAGG - Intronic
1192903422 X:75523594-75523616 TTCAAGCAGCAGTGGGAGGATGG - Intergenic
1193007983 X:76642720-76642742 TTAAAGAAGAAGAATGAGAAAGG + Intergenic
1194272489 X:91834460-91834482 TTCAAGGAACAGCTTGAGAAGGG - Intronic
1194980105 X:100431762-100431784 TTCAAAAAGGATCATGAAGAAGG + Intergenic
1195887829 X:109658642-109658664 GCCAAGAAGCAACATGAGAAAGG - Intronic
1195934581 X:110112725-110112747 GTGAAGAGGCAGCATGAGGGTGG - Intronic
1197210144 X:123821539-123821561 TTGAAAAAGCAGCATCAGGCCGG - Intergenic
1197868708 X:131045685-131045707 TTCAAGCATCAGGAGGAGGAAGG + Intergenic
1198113484 X:133523114-133523136 TTCAAGAGGAAGAATGTGGAAGG + Intergenic
1198279752 X:135130071-135130093 TTGAACAGGCCGCATGAGGATGG - Intergenic
1198291205 X:135242443-135242465 TTGAACAGGCCGCATGAGGATGG + Intergenic
1198392870 X:136193961-136193983 TTCAAGAAGCAGGATGCAGCTGG - Intronic
1198575042 X:138001067-138001089 TTCTAGAAGCAGGATGACAAAGG + Intergenic
1199427623 X:147721388-147721410 TTAAAGAAGCAGCATTAATATGG + Intergenic
1199707809 X:150445872-150445894 TTCAATAAGAAAAATGAGGAAGG + Intronic
1199759555 X:150894889-150894911 GTCAAGAATAAGCATGATGAGGG - Intronic
1200589733 Y:5055888-5055910 TTCAAGGAACAGCTTGAGAAGGG - Intronic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1200979513 Y:9248796-9248818 TCCAAGAAGGAGAAAGAGGATGG + Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201062324 Y:10058717-10058739 TCCAAGAAGGAGAAAGAGGATGG - Intergenic