ID: 1171366598

View in Genome Browser
Species Human (GRCh38)
Location 20:24629096-24629118
Sequence GAGGTGAATGCTCAGCTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171366592_1171366598 29 Left 1171366592 20:24629044-24629066 CCCATGCAAATGGCTTTGTTTCA 0: 1
1: 0
2: 0
3: 23
4: 259
Right 1171366598 20:24629096-24629118 GAGGTGAATGCTCAGCTGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1171366591_1171366598 30 Left 1171366591 20:24629043-24629065 CCCCATGCAAATGGCTTTGTTTC 0: 1
1: 0
2: 2
3: 23
4: 247
Right 1171366598 20:24629096-24629118 GAGGTGAATGCTCAGCTGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 174
1171366593_1171366598 28 Left 1171366593 20:24629045-24629067 CCATGCAAATGGCTTTGTTTCAG 0: 1
1: 1
2: 4
3: 24
4: 232
Right 1171366598 20:24629096-24629118 GAGGTGAATGCTCAGCTGAGAGG 0: 1
1: 0
2: 0
3: 14
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171366598 Original CRISPR GAGGTGAATGCTCAGCTGAG AGG Intronic
900323606 1:2096683-2096705 GCGGTGAATGTGGAGCTGAGCGG + Intronic
900832493 1:4975192-4975214 CAGCCGAATGCTTAGCTGAGGGG + Intergenic
902590155 1:17468280-17468302 GAGGTGAAGGCTGTGGTGAGCGG - Intergenic
902709725 1:18230545-18230567 GAGGTGGTGGCTCAGCTGACTGG + Intronic
904448752 1:30597577-30597599 GACCTGAGTGCTGAGCTGAGAGG + Intergenic
904456339 1:30650432-30650454 GAAGTGCAGGCTCAGCTCAGGGG - Intergenic
904605591 1:31696122-31696144 CAGGTGGATGCCCAGCTGACGGG - Exonic
904644585 1:31956248-31956270 GAAGTGAAAGCTCACCAGAGGGG - Intergenic
906035452 1:42747842-42747864 GAGGTGAAGGCTCAGGGGAAAGG - Intronic
906745029 1:48215517-48215539 GAGATGGGTGCTGAGCTGAGTGG - Intergenic
907995159 1:59623685-59623707 TAGGTGAAGCTTCAGCTGAGAGG - Intronic
911163224 1:94702383-94702405 GAGCTGATTTCTCAGCTCAGAGG + Intergenic
915074556 1:153297764-153297786 GCTGTGAATGCCCAGCTGTGAGG + Intergenic
915300082 1:154946730-154946752 GAGGAGAATGCCCAGCTCCGGGG - Exonic
915973515 1:160370496-160370518 GGAGGGAATGCTCAGCTCAGAGG - Intronic
916484704 1:165248444-165248466 AAGATGAATGCTGAGCTGTGGGG + Intronic
917069519 1:171135003-171135025 GAGGTAGATTCCCAGCTGAGGGG + Intergenic
920251204 1:204623535-204623557 GAGCTGCATGCTCAGCAGTGAGG - Intronic
920346310 1:205307961-205307983 GAGCTGGAGCCTCAGCTGAGGGG - Intronic
921801019 1:219402460-219402482 GATGTGAATGCTTATCTTAGGGG - Intergenic
922585090 1:226728011-226728033 GTGGTGAATTTTCAGCTGAAGGG - Intronic
924785951 1:247199845-247199867 GATGTGCGTGCTCAGATGAGTGG - Intergenic
1063325630 10:5098877-5098899 GAGGTGAGTGCTTGGCGGAGAGG + Exonic
1065942059 10:30573827-30573849 GAATAGAAGGCTCAGCTGAGTGG - Intergenic
1069807981 10:71137844-71137866 CAGTTGATTGCACAGCTGAGGGG + Intergenic
1072630842 10:97145456-97145478 GAGGTGGATGCTCATCTGAAAGG - Intronic
1083749392 11:64753065-64753087 GAGGTCATTGCTGAGGTGAGAGG - Exonic
1084351479 11:68603079-68603101 GAGGTGGACGCTGAGCTGGGAGG + Intronic
1084774030 11:71363921-71363943 CAGGTCAAGCCTCAGCTGAGTGG - Intergenic
1091079493 11:132653459-132653481 AAGGGGGATGCTCAGCTGTGGGG - Intronic
1091308218 11:134554371-134554393 GAGGTCAATGCACAGCTGTTGGG + Intergenic
1091555107 12:1567010-1567032 TTTGTGAATGTTCAGCTGAGGGG + Intronic
1093078150 12:14778324-14778346 GAGGTGTAAGCTGGGCTGAGAGG + Intergenic
1093377053 12:18442509-18442531 GAGGTGAATTCTTAGAAGAGGGG + Intronic
1096801935 12:54116213-54116235 GAGGTCACTGCACATCTGAGTGG - Intergenic
1097092748 12:56520242-56520264 GAAGTGCCTGCTCAGCTCAGGGG - Intergenic
1098824214 12:75272546-75272568 GAGGTTAGCTCTCAGCTGAGAGG + Intergenic
1099867290 12:88299163-88299185 CATTTGAAGGCTCAGCTGAGAGG - Intergenic
1100608185 12:96169226-96169248 GAGGTCATTGCTCAGCTTTGAGG + Intergenic
1100874700 12:98949790-98949812 GAGGTCAAGGGTCAGCTAAGAGG + Intronic
1101235487 12:102784929-102784951 CAGGTGAAGGCTGAGCTGATTGG - Intergenic
1101862331 12:108493466-108493488 AAGGAGAATGCTCAGCATAGGGG - Intergenic
1103916047 12:124376243-124376265 GAGGGGCATGCTCTGCTGGGTGG - Intronic
1104023068 12:125006557-125006579 GAGGTGACTGCTCAGCTTGCAGG + Intronic
1106644279 13:31616065-31616087 GAAGAGAAAGCTGAGCTGAGAGG - Intergenic
1106802938 13:33274955-33274977 GTGGTAAATACTGAGCTGAGAGG - Intronic
1113100260 13:106710188-106710210 GACGTGAATGCCCAGTCGAGGGG + Intergenic
1113109217 13:106803970-106803992 GAACAGAATGCTCAGCTGAGTGG + Intergenic
1113871402 13:113562072-113562094 CAGGTGAAGGCCCAGCTGTGAGG + Intergenic
1118176714 14:63447915-63447937 GTTGTGACTGCTCTGCTGAGCGG - Intronic
1118323581 14:64767256-64767278 GAGCTGAATGCTCTGCCAAGTGG - Intronic
1119170771 14:72534824-72534846 GAGGAGAGTGCTCATCTGAGAGG - Intronic
1119424984 14:74529166-74529188 GAGGGGAATGCGCAGCTGGGAGG + Intronic
1119739456 14:77004824-77004846 CAGGTGTCTGCTCAGTTGAGGGG + Intergenic
1121959225 14:98243393-98243415 GATGTGAAGGGTGAGCTGAGAGG + Intergenic
1122932789 14:104942401-104942423 GGGCTGAATGCTGAGGTGAGTGG + Exonic
1122933487 14:104945371-104945393 GAGCTGAATGCTGAGGTCAGTGG + Exonic
1124128571 15:26963742-26963764 GAGGTGAAGGCTCTGCTAACTGG + Intergenic
1125907184 15:43403774-43403796 CACGAGAATGCTCAGCTGGGCGG - Exonic
1129973479 15:79801302-79801324 AAGCTGAATGCTCAGCTGTGGGG + Intergenic
1130099029 15:80877961-80877983 TAGGTGACAGCTCAGGTGAGAGG + Intronic
1134801536 16:17089397-17089419 GATGTGACTGCACAGCTGACTGG - Intergenic
1140841475 16:78843427-78843449 GATGCGAATGCCCAGCTCAGGGG + Intronic
1142243745 16:88958974-88958996 TAGGTGAATGAGCAGCTGACAGG - Intronic
1143276834 17:5717823-5717845 GAGGTGAATCATCTGCTGACGGG + Intergenic
1145288561 17:21524230-21524252 GGGGTGGATGTTCAGCTCAGGGG - Intergenic
1145785648 17:27592159-27592181 GTGGTAAATGCTCAGCATAGTGG + Intronic
1147560243 17:41504371-41504393 GAGCTGACTTCCCAGCTGAGTGG + Intronic
1151257115 17:72886483-72886505 GAGTTGAATGTTGAGCTGATGGG - Intronic
1151580590 17:74975691-74975713 GAGGAGAATGCCCATCTGAGTGG - Intergenic
1151749314 17:76027618-76027640 CAGGTGCAGGCTCAGCGGAGAGG + Intergenic
1152185537 17:78854446-78854468 AAGGTGAATTCTCAGATGATAGG - Exonic
1152887960 17:82863654-82863676 GGGGTCAATGCTGAGCTCAGGGG - Intronic
1153226051 18:2900786-2900808 CAGTTGACTGCTCTGCTGAGTGG - Intronic
1153981106 18:10311329-10311351 TAGGTGAATGATCAGTTTAGTGG + Intergenic
1154339911 18:13494118-13494140 GTGGTGATGGCTCTGCTGAGAGG + Intronic
1154363582 18:13686301-13686323 GAGGTGAATACACAGCTCAGAGG - Intronic
1154966866 18:21367091-21367113 GAGGTCAAAGGACAGCTGAGTGG + Intronic
1155353493 18:24929058-24929080 GAGGAGCATGCACAGGTGAGGGG + Intergenic
1157726773 18:49970408-49970430 GTGGTGAGTGCTCTGCTCAGAGG - Intronic
1160143113 18:76343421-76343443 GAGGTGCAAGGGCAGCTGAGCGG + Intergenic
1160367012 18:78335316-78335338 TAGGTGAAGGCACAGATGAGAGG + Intergenic
1163376876 19:16938487-16938509 GAGGGGGATGGTCAGCTCAGCGG + Intronic
1164161525 19:22628350-22628372 TGGGTGGATGCTCAGGTGAGAGG - Intergenic
1165132395 19:33641074-33641096 GGGCTGAGTCCTCAGCTGAGAGG + Intronic
1166984374 19:46650703-46650725 GAGGAGAAGGGTCAGCTCAGTGG - Intronic
1167869542 19:52356258-52356280 GAGATGCTTACTCAGCTGAGTGG + Intronic
1168238001 19:55075793-55075815 CAGGTGAATGCTCAGGTATGCGG + Intronic
926588280 2:14713166-14713188 GAAGTGCATGCACACCTGAGAGG - Intergenic
926785779 2:16517203-16517225 GATGTGCAAGCTCATCTGAGTGG + Intergenic
929427111 2:41854882-41854904 GAGCTGCAGGCTGAGCTGAGGGG - Intergenic
929960249 2:46490805-46490827 GCGGAGAATGATCAGCTGAATGG - Intronic
932765803 2:74469017-74469039 GAGGTGGAGGCTGCGCTGAGTGG - Intergenic
933833961 2:86231280-86231302 GAGGTGGAGGCTCGGCTGTGGGG - Intronic
934946766 2:98548050-98548072 GAGGTGAAAGGTCAGATCAGTGG + Intronic
935681024 2:105637032-105637054 GAAGTGAAGGCGCAGCAGAGGGG + Intergenic
936947361 2:117942569-117942591 GAGCAGAGAGCTCAGCTGAGAGG - Intronic
937584093 2:123525222-123525244 GAGGTGAAAGCACAGATAAGGGG + Intergenic
937816221 2:126253510-126253532 GAGGTGACTGTTGTGCTGAGTGG - Intergenic
944202314 2:197120768-197120790 GAGGTGAATGTTGAGCTGATAGG - Intronic
946301570 2:218827494-218827516 GAGGTGAGTTCAGAGCTGAGTGG + Intronic
947102577 2:226637246-226637268 AATTTGAATCCTCAGCTGAGTGG - Intergenic
1171366598 20:24629096-24629118 GAGGTGAATGCTCAGCTGAGAGG + Intronic
1171377998 20:24708340-24708362 GAGATGAGTGCTCTGCGGAGGGG + Intergenic
1173090018 20:39961526-39961548 GAAAAGAATGCTCAGCAGAGTGG - Intergenic
1176656182 21:9590710-9590732 GGGCTGAATCCTCAGGTGAGGGG + Intergenic
1181757252 22:25032646-25032668 GAGAAGAGTGCTGAGCTGAGCGG + Exonic
1182651125 22:31852047-31852069 GTGGTGAATGCTGAGGTGGGAGG + Intronic
1182667991 22:31972991-31973013 GAGGTGAAAGCCCAGGTGTGAGG + Intergenic
1184508860 22:44920260-44920282 GAGGGGAAGGTGCAGCTGAGAGG + Intronic
1184896366 22:47409450-47409472 GAGGGGAAGGCTCAGCTCAGGGG - Intergenic
1185150177 22:49159765-49159787 GAGGTGGATCCTAAGTTGAGAGG - Intergenic
949391280 3:3565354-3565376 GAGCTGAATGCTCAGCAAATGGG + Intergenic
952392277 3:32890819-32890841 GAGGTGAGTGATCAGCAGAATGG + Exonic
952836842 3:37609975-37609997 GAAGTGAATGCCCAAATGAGTGG + Intronic
953097174 3:39789600-39789622 GAGCTGAATTCTCACATGAGAGG - Intergenic
954863731 3:53711675-53711697 CATGGGAATGCTGAGCTGAGAGG + Intronic
955384083 3:58464969-58464991 GAAGTGAATGCTGAGCAAAGGGG + Intergenic
957608166 3:82431330-82431352 GAGCTGTTTGCTGAGCTGAGCGG - Intergenic
958576261 3:95952623-95952645 GAGCTGATATCTCAGCTGAGGGG + Intergenic
962923603 3:139972436-139972458 GATGTGAATACTAAGCTGAGTGG + Intronic
963534296 3:146508618-146508640 CAGGTGAAGGTTCAGATGAGTGG + Intergenic
965247116 3:166286959-166286981 CAGGAGAATGCTCAGCTTATGGG + Intergenic
965829193 3:172764421-172764443 AAAGGGAATGCTCAGCTGATGGG - Exonic
967984618 3:195085784-195085806 GAGGTGAGTGCTCAGAGCAGTGG - Intronic
969036579 4:4258696-4258718 GAGCAGAATGCCCAGCTGTGAGG + Intergenic
969345191 4:6565390-6565412 GTGCAGAAAGCTCAGCTGAGGGG - Intergenic
971735141 4:30439549-30439571 GAGGTGAATTCTCAAATGATAGG + Intergenic
977797684 4:101187041-101187063 GAGGTGAATATCCTGCTGAGTGG + Intronic
981830690 4:148997242-148997264 GAGGTCAAGGCTCACGTGAGAGG + Intergenic
983662004 4:170138077-170138099 GGGATGCATGCACAGCTGAGAGG + Intergenic
984521565 4:180808317-180808339 GAGGTTAATGCCCAGCGGACAGG + Intergenic
986872573 5:12067470-12067492 GAAGTGAAGTCTCAGCTGAGAGG + Intergenic
988796666 5:34657645-34657667 GAGGAGAATGCCCAGCTGCCTGG + Intronic
995667849 5:114564860-114564882 GACGTGGATGCTCAGGTGAGAGG - Intergenic
995752782 5:115471216-115471238 GAGGTGAGTCCTCTGCTGATTGG + Intergenic
1001019829 5:168173496-168173518 GAGGTGAATGAGGGGCTGAGGGG - Intronic
1001534756 5:172490652-172490674 CAGGGGAGTGCTCAGCTTAGGGG + Intergenic
1003148282 6:3527242-3527264 GGGGTGAACCCACAGCTGAGTGG - Intergenic
1003466647 6:6386444-6386466 GATGTGAATGCCATGCTGAGTGG - Intergenic
1004921554 6:20380928-20380950 GATGTGAAGGCACAGCTCAGAGG - Intergenic
1004980020 6:21012784-21012806 AGGGTGAATGCTCTTCTGAGTGG + Intronic
1005084591 6:21992069-21992091 AAGGTGAAAGCTGAGCAGAGGGG - Intergenic
1006091437 6:31631335-31631357 GAGGAGACTGCACAGCTGACGGG + Exonic
1006391432 6:33761289-33761311 GGGCTGAAGGCTCAGCAGAGAGG - Intergenic
1006780625 6:36630000-36630022 GAGGTCAAGGCTCCGGTGAGTGG + Intergenic
1007414980 6:41686263-41686285 GAGGTGCATGCTCAGAAGAGTGG + Intronic
1011888338 6:92125886-92125908 GAGCTGAACGCTCTGCTTAGTGG - Intergenic
1014774280 6:125490748-125490770 GAGGCGAATGCTGAGGAGAGAGG + Intergenic
1018616496 6:165691758-165691780 GTGGTGCCTGCTGAGCTGAGAGG - Intronic
1019013979 6:168866649-168866671 AAGCTCAGTGCTCAGCTGAGGGG - Intergenic
1019014008 6:168866803-168866825 AAGCTAAGTGCTCAGCTGAGAGG - Intergenic
1019571751 7:1716121-1716143 GAGGAGCAGGCACAGCTGAGAGG - Intronic
1019619783 7:1986288-1986310 GAGGTTGGTGCTGAGCTGAGGGG - Intronic
1021211805 7:17863148-17863170 GAGCAGAATTCTCAGCTCAGGGG + Intronic
1022165207 7:27752740-27752762 GAGTATAATGCTCAGATGAGAGG - Intronic
1022711575 7:32855626-32855648 GAGGAGGATTCCCAGCTGAGTGG - Intergenic
1022913080 7:34919332-34919354 GAGGAGGATTCCCAGCTGAGTGG + Intergenic
1027226960 7:76249679-76249701 AAGGGGAAGGCTCATCTGAGTGG - Intronic
1028838092 7:95396578-95396600 GAGGTCAAGGCTCAACGGAGAGG + Intergenic
1032326897 7:130937259-130937281 GATGCGAAGGCTCAGCTGATGGG - Intergenic
1034010426 7:147523604-147523626 GAGGAGGAGGCTCAGCTGTGTGG - Intronic
1034740800 7:153471694-153471716 GAGGTGCAAGGTCAGATGAGCGG + Intergenic
1035120085 7:156559641-156559663 GAGGTGAATGCTGTCCTCAGGGG - Intergenic
1041629665 8:60072637-60072659 GAGGTGAATAATCAGCAGAGCGG - Intergenic
1042226677 8:66519979-66520001 GAGGTGAATCCTGAGCTCGGAGG - Intergenic
1043432340 8:80207163-80207185 CAGGTGCATGAGCAGCTGAGAGG - Intronic
1047215242 8:122870784-122870806 GCTGTGACTGCTCAGTTGAGAGG - Intronic
1049303427 8:141883886-141883908 GAGGTGTCTGCTGTGCTGAGGGG - Intergenic
1050199912 9:3133200-3133222 GAGGAGAAGTCTCAGCTGATTGG + Intergenic
1050637275 9:7625741-7625763 GAGATGAATGCTGAGGAGAGTGG + Intergenic
1053618517 9:39793290-39793312 GAGGTGACAGGTCAGCTAAGTGG + Intergenic
1053876687 9:42552651-42552673 GAGGTGACAGGTCAGCTAAGTGG + Intergenic
1053895987 9:42742054-42742076 GAGGTGACAGGTCAGCTAAGTGG - Intergenic
1054235010 9:62549071-62549093 GAGGTGACAGGTCAGCTAAGTGG - Intergenic
1054265639 9:62914139-62914161 GAGGTGACAGGTCAGCTAAGTGG - Intergenic
1054952334 9:70866601-70866623 CAGATGAAGGCTCAGATGAGGGG + Intronic
1055388429 9:75791092-75791114 GGGGTGAATACTCAGGTGATGGG - Intergenic
1057302273 9:93893869-93893891 CAGGTGAGGGCTCAGCAGAGAGG + Intergenic
1060138418 9:121181356-121181378 GAGGTGAAAGGTCAAATGAGGGG + Exonic
1061267045 9:129512287-129512309 TAGATGAATGCTCAGCTCTGGGG + Intergenic
1203633898 Un_KI270750v1:94170-94192 GGGCTGAATCCTCAGGTGAGGGG + Intergenic
1186227036 X:7410421-7410443 GAAGTGAGTGCTGAGCAGAGGGG - Intergenic
1190157552 X:48006073-48006095 GAGGTGAATGAACACCAGAGTGG + Intronic
1190173322 X:48128958-48128980 GAGGTGAATGAACACCAGAGTGG + Intergenic
1190287148 X:48969282-48969304 GAGGAGAAAGCCCAGCTCAGAGG + Exonic
1191270660 X:58463464-58463486 GAGGTGAATGCACACATCAGAGG + Intergenic
1192554698 X:72080286-72080308 AGGGTGCATGCTCAGCAGAGGGG + Intergenic
1200150646 X:153949833-153949855 GAGGTGGGAGCTGAGCTGAGTGG - Intronic