ID: 1171367109

View in Genome Browser
Species Human (GRCh38)
Location 20:24632784-24632806
Sequence GTGGCTTTACAAGGAAACAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 201}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171367099_1171367109 29 Left 1171367099 20:24632732-24632754 CCCTTCAAGTATTTAGTGCCAGC 0: 1
1: 0
2: 0
3: 10
4: 106
Right 1171367109 20:24632784-24632806 GTGGCTTTACAAGGAAACAAGGG 0: 1
1: 1
2: 0
3: 11
4: 201
1171367106_1171367109 -10 Left 1171367106 20:24632771-24632793 CCTGTAAATAATTGTGGCTTTAC 0: 1
1: 0
2: 1
3: 5
4: 168
Right 1171367109 20:24632784-24632806 GTGGCTTTACAAGGAAACAAGGG 0: 1
1: 1
2: 0
3: 11
4: 201
1171367104_1171367109 11 Left 1171367104 20:24632750-24632772 CCAGCTGGAGGGATAAAGAGACC 0: 1
1: 0
2: 3
3: 10
4: 144
Right 1171367109 20:24632784-24632806 GTGGCTTTACAAGGAAACAAGGG 0: 1
1: 1
2: 0
3: 11
4: 201
1171367100_1171367109 28 Left 1171367100 20:24632733-24632755 CCTTCAAGTATTTAGTGCCAGCT 0: 1
1: 0
2: 1
3: 7
4: 110
Right 1171367109 20:24632784-24632806 GTGGCTTTACAAGGAAACAAGGG 0: 1
1: 1
2: 0
3: 11
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171367109 Original CRISPR GTGGCTTTACAAGGAAACAA GGG Intronic
900337831 1:2173500-2173522 ATGGCTGTAGAAGGAAACACAGG + Intronic
902251084 1:15154427-15154449 GTCGCTCTACAAGCAAACACGGG + Intronic
906555479 1:46708944-46708966 GTGGCTTTAAAAAAAAAAAAAGG - Intronic
909650205 1:77966446-77966468 GTGGCTTTACAAGTAGAGACTGG + Intronic
912382942 1:109257374-109257396 ATGGCTTTACAGGGCAAGAAGGG - Intronic
912944140 1:114070583-114070605 ATGGGTTTAGAAGGAAACAGGGG + Intergenic
913085638 1:115434195-115434217 AGGGCGTCACAAGGAAACAAAGG - Intergenic
915662931 1:157418594-157418616 GTGGCTCTACCTGGAAACAGGGG + Intergenic
916361986 1:163980612-163980634 GTGGTTTTTCCAGGAAAGAAAGG - Intergenic
917382565 1:174429777-174429799 GTGGATTTAGGGGGAAACAAAGG + Intronic
919524055 1:198625284-198625306 GTGTCTCTCAAAGGAAACAAAGG + Intergenic
924103574 1:240628707-240628729 GTGTGTTTAAAAGAAAACAATGG + Intergenic
924427267 1:243963589-243963611 ATGTCTTTACAAGCCAACAACGG - Intergenic
1063488486 10:6441907-6441929 GTGGCTGGAGAAGGAAGCAAAGG - Exonic
1063989870 10:11548921-11548943 ATGGGTTTAAAAGGAAATAATGG - Intronic
1067217362 10:44314266-44314288 GTGTCACTACAAGGAAAGAAAGG + Intergenic
1067276656 10:44841221-44841243 GTGGCTTTACAAGAAAAGGAAGG + Intergenic
1067279947 10:44863729-44863751 GTTGCTTAAAAAGGAAAGAAAGG + Intergenic
1068063377 10:52098244-52098266 CTGACTTTACAAGGAACAAAGGG - Intronic
1074214132 10:111367713-111367735 GTGGCTTCACAGAGAACCAAGGG - Intergenic
1074674245 10:115830150-115830172 GTGGATATACAAGTGAACAAAGG + Intronic
1076045611 10:127291994-127292016 GTGGCTTGACAAGGATGCACAGG + Intronic
1076620227 10:131782545-131782567 GAGGCTTTAGGAGGAAAGAAGGG - Intergenic
1078040088 11:7852661-7852683 CTCACTTTATAAGGAAACAAAGG - Intergenic
1078391234 11:10937264-10937286 ATGGCTTTAAGAGGCAACAAGGG + Intergenic
1080064400 11:27993534-27993556 GTTGCTTTATAAGAAAAAAATGG + Intergenic
1080234139 11:30049426-30049448 AAGGCTTTACAAGTAAACAAGGG + Intergenic
1081378252 11:42385665-42385687 ATGTCCTTAAAAGGAAACAATGG + Intergenic
1087195010 11:95296497-95296519 ATGGCTTGAGAAAGAAACAAGGG + Intergenic
1088383439 11:109222250-109222272 GTAGTTTTACATGGAAAAAATGG - Intergenic
1090685700 11:129116049-129116071 GTTACTTTTCAAGTAAACAAGGG + Intronic
1091237159 11:134030000-134030022 GTGTCTGTACAAGCAAACGATGG + Intergenic
1091607875 12:1972127-1972149 GTGGCTTTCCAAGTAAAAAGAGG - Intronic
1095204167 12:39420386-39420408 GAGGCTTTACAAAGAACCCAAGG + Intronic
1095788451 12:46137216-46137238 GTGGCTTGACAAAGAAAGAGTGG - Intergenic
1097501498 12:60409681-60409703 GTGGCTCTACAAGGTCACCATGG + Intergenic
1098367442 12:69719661-69719683 CTGGCTTTGCTAGGAAACTAAGG + Intergenic
1099846945 12:88039159-88039181 TTAGCTTTGCAAGGAAAAAAAGG + Intronic
1099941312 12:89192583-89192605 GTGGCATCACAAGTAAACATTGG + Intergenic
1101277412 12:103217789-103217811 GGGGCTCTACAAGGAAGGAAAGG - Intergenic
1104104108 12:125642847-125642869 GTAGCTTGACATGGAAACCAAGG - Intronic
1104220722 12:126782351-126782373 GTGGCTTTAGCAGGATTCAAAGG + Intergenic
1104626378 12:130359161-130359183 GTGGACTTACAAGAAAACTATGG - Intronic
1107094389 13:36518909-36518931 GGTGCTTAACAAGGAAAGAAAGG + Intergenic
1107750411 13:43559158-43559180 GTGCCTGTACAAGGAAGCAGGGG + Intronic
1108066236 13:46580460-46580482 GTAGCATTACAAGAAAACATGGG - Intronic
1108091164 13:46851585-46851607 GTGGCTTTACAAGGGCAGGATGG + Intronic
1109136657 13:58659933-58659955 GGGTCATTACAAGAAAACAAAGG - Intergenic
1110681804 13:78322520-78322542 GTGGGTTCAGGAGGAAACAATGG + Intergenic
1111053446 13:82916620-82916642 GTGACTTTCCAAGGAAAGCAGGG + Intergenic
1114730716 14:24989995-24990017 GTGGCTTCAGATGGAGACAATGG + Intronic
1118376394 14:65180948-65180970 GTGTCTTCAGAAGGACACAAAGG + Intergenic
1121391128 14:93575850-93575872 GAGGCTTGACAAGGAAAGAGTGG - Intronic
1121939916 14:98060462-98060484 GTGGCGTAACAATGTAACAAAGG - Intergenic
1122044745 14:99015613-99015635 GAGGTCTTACAAGGAGACAAAGG - Intergenic
1123223590 14:106879285-106879307 ATGGATTTACAAGGAAGTAATGG + Intergenic
1124024746 15:25954921-25954943 ATGGCTTTAAAAGAAAAGAAAGG - Intergenic
1124358925 15:29020179-29020201 GTGGGTATACAAGCAAAAAAAGG + Intronic
1125171411 15:36770261-36770283 GTGGCTTGATCAGGAAAAAAAGG + Intronic
1127217333 15:56837418-56837440 GTGCCTTTTAAAGGAAAGAATGG - Intronic
1132079017 15:98848736-98848758 GTGCCTTTAGAAGGACACAATGG - Intronic
1134340800 16:13343915-13343937 GTGGATTAACAAGGAGAGAAAGG + Intergenic
1135820730 16:25683214-25683236 GTGACCTTACAAGAAGACAAAGG + Intergenic
1135936391 16:26784025-26784047 TTGGCTTTTCAAGGAAACTCTGG - Intergenic
1136680278 16:31956679-31956701 GTGGATTTACAAGGAAGAAATGG - Intergenic
1136780621 16:32898224-32898246 ATGGATTTACAAGGAAGAAATGG - Intergenic
1136889792 16:33961446-33961468 ATGGATTTACAAGGAAGAAATGG + Intergenic
1137524221 16:49219768-49219790 GTGACTTTACCTCGAAACAAGGG - Intergenic
1140568717 16:76076180-76076202 GTTTATTTAAAAGGAAACAAAGG - Intergenic
1203083275 16_KI270728v1_random:1162253-1162275 ATGGATTTACAAGGAAGAAATGG - Intergenic
1143633816 17:8153076-8153098 GTGGCTGTGAAGGGAAACAATGG + Intronic
1144921642 17:18768880-18768902 GTTACTTCACAAGAAAACAAGGG - Intronic
1149188356 17:54029143-54029165 GCAGCTTTTAAAGGAAACAAAGG + Intergenic
1149348639 17:55765026-55765048 ATGGCTTACCAAGGAAACAAGGG + Intronic
1151937501 17:77271755-77271777 GTGGCTTTAACAGGCAACCAGGG - Intergenic
1157610255 18:48951280-48951302 GGGGCTTTGCAAGGAAACGGGGG - Intergenic
1159476710 18:68930095-68930117 GAAGATCTACAAGGAAACAAAGG + Intronic
1159627555 18:70712453-70712475 GGGGATTTACAAGGAAATCAAGG - Intergenic
1160088813 18:75806725-75806747 GTTTCTTTACCAGGCAACAAAGG + Intergenic
1161608951 19:5230236-5230258 GGGGCTGTCCAACGAAACAAAGG + Intronic
1162236939 19:9316874-9316896 GGGGCCTTACAATGAACCAAGGG + Intergenic
1164452930 19:28382247-28382269 GAGGGTTTAGAAGGAAGCAATGG + Intergenic
1166646922 19:44539047-44539069 GGGGATTTACCAGGAAAGAATGG - Intergenic
925483329 2:4301199-4301221 GTAGCTTTGCCAGGAAAGAAAGG + Intergenic
927524879 2:23729506-23729528 CTGGCTTTACAAGCAGAAAAGGG - Intergenic
928656107 2:33453264-33453286 GGGGTTTCAAAAGGAAACAAAGG - Intronic
928656219 2:33454570-33454592 GGGGTTTCAAAAGGAAACAAAGG - Intronic
929252845 2:39778913-39778935 TTTGCTATACAAGGAAAGAAAGG + Intronic
931143184 2:59486129-59486151 TTGTCTTTACAAAGAAATAATGG - Intergenic
933181820 2:79235764-79235786 GATGCTTCACAAGGAAACATGGG + Intronic
936106658 2:109630653-109630675 GTGGCTATGAGAGGAAACAAAGG - Intergenic
936268347 2:111028690-111028712 GAGGCTTTTCAAGAAAAGAAAGG + Intronic
937067774 2:119031167-119031189 GTGGCTTCAGAAGGAAAAAAAGG + Intergenic
938078258 2:128353610-128353632 GTGGCTTTACAAGAAGAGGAAGG + Intergenic
938631863 2:133176241-133176263 GTGGCTTTTCATGGCAACATGGG - Intronic
940441957 2:153726631-153726653 GTTTCTTAACAAGGAAAAAATGG - Intergenic
940653177 2:156457602-156457624 GTGTCTTTTCAGGGAAACAATGG + Intronic
940866306 2:158820809-158820831 GTGGCTTTATAAGGAGAAGAAGG + Intronic
942277053 2:174331034-174331056 GTGGCTTTGCAAATAAATAAAGG + Intergenic
942478518 2:176356233-176356255 GTATCTATACAAAGAAACAAAGG - Intergenic
944491189 2:200259245-200259267 GCGGCTCCAAAAGGAAACAAAGG + Intergenic
944684793 2:202108769-202108791 GTGTCTTTACAATGGAAAAATGG - Intronic
944932581 2:204535150-204535172 GATGCTTTACATGGAAACGAGGG - Intergenic
945476285 2:210285706-210285728 GTGGCTTTACTGGGATAAAATGG + Intergenic
945846122 2:214947163-214947185 GTGCGTTTCCAAGGAAACACTGG - Intronic
947411609 2:229847109-229847131 GTGACTTAACAAGGAAAGAGTGG + Intronic
948668047 2:239548542-239548564 GTGACTTTCAAAGAAAACAACGG - Intergenic
948748366 2:240111827-240111849 ATGGCTCTACAAGAAAACATCGG - Intergenic
1170927805 20:20741743-20741765 GTGGATTTAGAAGGAAGCGAGGG + Intergenic
1171367109 20:24632784-24632806 GTGGCTTTACAAGGAAACAAGGG + Intronic
1172032727 20:31993139-31993161 GTGGCTTTCCCAGGAAACTGGGG - Intronic
1172484456 20:35290087-35290109 GTGGCTTCACAGGGAAACTGAGG - Intronic
1172980526 20:38938122-38938144 GAGGCTTTAAAACCAAACAATGG + Intronic
1173833709 20:46111120-46111142 GAGGCTTGACAAGGAAGCCAAGG + Intergenic
1173883427 20:46436360-46436382 GAGCCTTCATAAGGAAACAAAGG - Intergenic
1174527202 20:51182505-51182527 GTTGGTTTACAAGAAAAAAATGG - Intergenic
1179450616 21:41466096-41466118 GTCGTTTTACAAGAAAACAATGG - Exonic
1180243431 21:46528096-46528118 ATGGCTTTCCAAGTAAAGAATGG + Intronic
1180966450 22:19790473-19790495 GCAGCTATACAAGGAAACATAGG - Intronic
949118589 3:358459-358481 GTTACTTTACATGGAAAAAAGGG - Intronic
949441530 3:4086336-4086358 GTGACTTTCCAAGGGCACAAAGG - Intronic
949561303 3:5205261-5205283 TTTGCTTTACAAGGCAACAGAGG - Intronic
955029963 3:55206405-55206427 TTGGCTTTATAAGGAAATACAGG + Intergenic
955517148 3:59737481-59737503 GTTGCTGCATAAGGAAACAAGGG + Intergenic
955986200 3:64576516-64576538 AAAGCTTTACCAGGAAACAAGGG + Intronic
956756408 3:72392322-72392344 GAAGCTTTTCAAGGAAAGAATGG + Intronic
956838438 3:73115012-73115034 GTGGCTTTAAAAAGAGAGAAAGG - Intergenic
956938256 3:74128683-74128705 GATGCTTTAGAAGGAAATAAAGG + Intergenic
957891330 3:86363044-86363066 TTGACTCAACAAGGAAACAAGGG - Intergenic
958025547 3:88044604-88044626 GTAGCCTTAAAAGGAAAGAAAGG - Intergenic
958931866 3:100215992-100216014 GTGGATTAAAAAGGACACAAAGG - Intergenic
961403755 3:126664908-126664930 GTGGCTTAACAAGGATACTTGGG - Intergenic
962255096 3:133865105-133865127 GTGGCTTTCTAAGGAACCAGGGG + Intronic
962596346 3:136948791-136948813 GTGCCTTTACAAGGAAACAAAGG - Exonic
964236926 3:154542287-154542309 CTGGCTATACAAGGAAAAAGAGG + Intergenic
964395808 3:156244443-156244465 GTTGCTTTACATGGCAAAAAGGG - Intronic
967650345 3:191977938-191977960 GAGGCATAAGAAGGAAACAATGG + Intergenic
970373935 4:15437214-15437236 GTGGCTATACAAACAAACATTGG + Intronic
970506600 4:16736523-16736545 ATGGCTTTACTAGAAAACAATGG + Intronic
973805441 4:54521678-54521700 GTCGGTTTTCAAGGAAACAGGGG - Intergenic
974222903 4:58999517-58999539 TTGGCTTTACAAATAAAAAAGGG - Intergenic
974294482 4:59979454-59979476 GTGGGTTTTGAAGGGAACAACGG - Intergenic
976191143 4:82488260-82488282 GTAGCTTTAGAATGAAACAATGG - Intronic
976555863 4:86451065-86451087 GGAGATTTACAAGGTAACAAAGG + Intronic
976750316 4:88446195-88446217 GCCCCTTTACAAGGCAACAAGGG + Intergenic
976827688 4:89278965-89278987 GAGGCTTTAAATGGAACCAAGGG - Intronic
977168501 4:93730682-93730704 GGGGGTTGACAAGAAAACAACGG + Intronic
977360423 4:95997467-95997489 GTGTCCTTACAAGGAAATGAAGG - Intergenic
977577551 4:98691085-98691107 GTGGCATTAAGGGGAAACAATGG - Intergenic
977636102 4:99300174-99300196 GTTGCTTTACAGGGCAAAAATGG + Intergenic
978338144 4:107691716-107691738 GTGGGGACACAAGGAAACAAAGG - Intronic
978968402 4:114771432-114771454 GTGTCTTTAAAAAGAAAAAAAGG - Intergenic
979018892 4:115469018-115469040 GTGGCTTTATAAGGAGAGGAAGG + Intergenic
980344102 4:131590224-131590246 GTGGCTTTAATAGGAGACCATGG + Intergenic
981179175 4:141718142-141718164 GAGGCTTTACAATGTCACAATGG - Intronic
985058180 4:186053364-186053386 GCTGGTTTACAAGGATACAAGGG + Intergenic
990598669 5:57335770-57335792 GTGAATTTACAGAGAAACAAAGG + Intergenic
991129701 5:63107914-63107936 GAGCCTTTAAAAGGAAATAATGG - Intergenic
991269138 5:64758429-64758451 CAGGGTTTACAGGGAAACAATGG - Intronic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993579911 5:89647726-89647748 GTAGCCTTACTAGGAAATAATGG + Intergenic
997010534 5:129871959-129871981 GTAGCATTACAAGGAAGGAAGGG + Intergenic
997843850 5:137267831-137267853 GTGGGTGTGCCAGGAAACAATGG - Intronic
998618099 5:143763067-143763089 GTGGGTTGCCAAGGAATCAATGG - Intergenic
999386334 5:151156835-151156857 GTCTCTTTCAAAGGAAACAATGG - Intronic
1001121329 5:168982961-168982983 GTGAAATTACAAGGCAACAAGGG - Intronic
1002075311 5:176705042-176705064 GTGGCTTCTCTAGGAAACACAGG - Intergenic
1002312067 5:178320817-178320839 GTGGCTTTAGAGGGAAAGGAGGG - Intronic
1003133610 6:3416439-3416461 ATGGCTTTAGAGGGAAACATGGG - Intronic
1004895967 6:20148055-20148077 GTGGCTTGGGAAGGAAACACAGG + Intronic
1009315565 6:62215039-62215061 TTAGCTTTCTAAGGAAACAATGG - Intronic
1009461780 6:63921994-63922016 GTGGCCTTATAAGAAAAGAAAGG + Intronic
1009942820 6:70308703-70308725 GTGCCCATACCAGGAAACAAGGG - Intergenic
1010028951 6:71252682-71252704 GAGGCTTGAAAAGGAAATAAAGG + Intergenic
1012102929 6:95114584-95114606 GGGGCTTAAAAAGAAAACAAAGG - Intergenic
1013009598 6:106107328-106107350 GTGTCTTTGCAAAGAAACATGGG + Exonic
1013075288 6:106765572-106765594 GTGGCTTCAAAGAGAAACAAGGG + Intergenic
1016349040 6:143147436-143147458 GTTGATTTTTAAGGAAACAAAGG - Intronic
1016435582 6:144034143-144034165 GTGGTTTTACATGTAAACACAGG - Intronic
1016454961 6:144221278-144221300 GTGGCTTTTGCAGGAAAAAAGGG + Intergenic
1018296117 6:162345971-162345993 GTGGCTTTATAAGAAGAGAAAGG + Intronic
1020147659 7:5657013-5657035 GTGGCTTTGCAAGGAAGGCAAGG - Intronic
1021690452 7:23225683-23225705 GTGGATTTACAAGGATGAAAAGG + Intergenic
1022327219 7:29343394-29343416 GTGGCAATACAGGGAGACAAGGG - Intronic
1023896446 7:44437380-44437402 GAGAATTTACAAAGAAACAAAGG - Intronic
1024733713 7:52279948-52279970 GTGGCTTTGAAGGGAAACATGGG - Intergenic
1029929639 7:104357282-104357304 GTGACTTGTCAAGGAAGCAAAGG - Intronic
1030755232 7:113279547-113279569 ATGGCTTCATTAGGAAACAAAGG + Intergenic
1031965756 7:128027189-128027211 TTAGCTTTAAAAGGAAATAAGGG - Exonic
1034278141 7:149833147-149833169 GAGGCTGAGCAAGGAAACAAAGG - Intergenic
1035723947 8:1813321-1813343 GTAGGTTTACAAGGGAACAAGGG - Intergenic
1037533333 8:19801514-19801536 TTGGCTTTATAAGGAGAAAAGGG + Intergenic
1038475583 8:27864308-27864330 ATGGATTTGCAAGGAAACATGGG - Intergenic
1038773197 8:30503129-30503151 ATGGCATTAACAGGAAACAAGGG - Intronic
1040047745 8:42980586-42980608 GTGGCTTTATAAGAAAAAGAGGG + Intronic
1042368320 8:67962238-67962260 GAGGCATTACAAGGCACCAAGGG - Intronic
1043165074 8:76893434-76893456 CTGGCCTTACAAGGAAAGGAAGG - Intergenic
1043936465 8:86148304-86148326 GTGGCTTTATGTGGAAGCAAGGG - Intronic
1051700293 9:19815509-19815531 GGGGTTTTAAAAGGAAAAAAAGG - Intergenic
1052750514 9:32484975-32484997 TTGGATTTAAAAGGAAAAAAAGG + Intronic
1057865826 9:98679967-98679989 GAGCCTTCATAAGGAAACAAAGG - Intronic
1058929409 9:109704287-109704309 GTGGCTTTACAGGCTAAAAAGGG - Intronic
1061612639 9:131757754-131757776 GTGGCTAGAAAAGGAAACCAGGG + Intergenic
1185929286 X:4184332-4184354 GTGGCTTCAGAGGGACACAAAGG - Intergenic
1189353006 X:40291102-40291124 CTGGATTTACAAAGAAAAAAGGG + Intergenic
1190143545 X:47869629-47869651 CTGGCTTCACAAGGAAAGCATGG + Intronic
1190393120 X:49952359-49952381 TTGGCTTTACAAAAAAAAAAAGG + Intronic
1190799075 X:53771818-53771840 GTGGCTTAAGAAGGAAAAAGTGG + Intergenic
1194540859 X:95170690-95170712 GAGGCTGTTCAATGAAACAAAGG + Intergenic
1196199766 X:112872266-112872288 TAGGATTTACAATGAAACAATGG + Intergenic
1196522695 X:116693223-116693245 CTTCCTTTACAGGGAAACAATGG - Intergenic
1196709665 X:118749607-118749629 TTTGCATTACAAGGAAAGAAGGG + Intronic
1197738577 X:129871727-129871749 CAGGCATTACAAGGAGACAAGGG + Intergenic
1198269511 X:135042043-135042065 GTGGCTTTATAAGAAGAGAAAGG + Intergenic