ID: 1171370655

View in Genome Browser
Species Human (GRCh38)
Location 20:24660249-24660271
Sequence TGTCCACTCATTTACGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171370655 Original CRISPR TGTCCACTCATTTACGGGAG TGG Intronic
902941615 1:19804116-19804138 TGTCTACTCAGTTAGGGGTGTGG + Intergenic
920285077 1:204873458-204873480 TGTCCACTAAACCACGGGAGTGG - Intronic
1063126164 10:3138395-3138417 TGTGCACTCATGTCCCGGAGGGG + Intronic
1065179673 10:23112320-23112342 GATGCACTCATTTATGGGAGAGG + Intronic
1066536524 10:36398001-36398023 TGTCCTCCTATTTACGGCAGAGG + Intergenic
1067571529 10:47375036-47375058 TGTCCACTCAGTTTCGTCAGGGG - Intronic
1074903381 10:117839143-117839165 TGTTCCCTCATTTTCTGGAGGGG + Intergenic
1075856466 10:125634110-125634132 TGTATATTCATTTAAGGGAGGGG + Intronic
1086424771 11:86672400-86672422 GGTCCACCCATTGGCGGGAGAGG - Exonic
1087297802 11:96397971-96397993 TGTTCATTCATTGACGAGAGTGG - Intronic
1088961342 11:114668813-114668835 TGTCCAGTTATTTCTGGGAGAGG - Intergenic
1089491400 11:118886455-118886477 TGTCCACTTCTTTAAGGCAGGGG + Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1094615506 12:32032844-32032866 TGTCAACTCCTTTAGGGTAGGGG + Intergenic
1099512935 12:83559705-83559727 TGCCCACTCATTTAGAGAAGAGG + Intergenic
1112779231 13:102879896-102879918 TCTTCACTCACTTCCGGGAGTGG + Intergenic
1114739519 14:25080888-25080910 TATCCACTCATGAATGGGAGGGG + Intergenic
1116273497 14:42801824-42801846 TGTCCACTGATGTTTGGGAGAGG + Intergenic
1117844510 14:59896929-59896951 TGTGCACTCATTTAGGGTAGCGG + Intergenic
1126188302 15:45852724-45852746 TGTCCACTCCTTTACTGCTGTGG - Intergenic
1130338039 15:82974447-82974469 TCTCCACTCACCTATGGGAGGGG + Intronic
1142488580 17:262772-262794 TCTCCACTGATTTAGGGCAGGGG - Intronic
1144863645 17:18321278-18321300 TGTTCACTCAGTGAGGGGAGCGG - Intronic
1161727006 19:5935320-5935342 TGACCAGTCTGTTACGGGAGAGG - Intronic
1164702781 19:30297667-30297689 TGGCCACTCGTTTACTCGAGCGG - Intronic
926031297 2:9592072-9592094 TGTGCACTCATTTTAGGGACGGG + Intronic
927451333 2:23211915-23211937 TATCCTCTCATTTAGGGGAAAGG - Intergenic
927460301 2:23292952-23292974 TGTCCCCTCATTTTGGGAAGAGG - Intergenic
937430423 2:121833325-121833347 CGTGCACTGATTTAGGGGAGGGG - Intergenic
943447779 2:188010347-188010369 TCTCCTCTCATTTATGTGAGGGG + Intergenic
948542318 2:238699517-238699539 CGCCCACTCATTTGGGGGAGGGG - Intergenic
1171370655 20:24660249-24660271 TGTCCACTCATTTACGGGAGTGG + Intronic
1172654547 20:36528808-36528830 TGCACACTGATTTTCGGGAGAGG - Intergenic
1173428244 20:42961578-42961600 TGTGCACTCCTTTAGGGCAGGGG + Intronic
1176986721 21:15445787-15445809 TGTCCATTCCTTTAAGGGATAGG - Intergenic
1179942360 21:44648500-44648522 TGTCCACTTATTTATGGGGATGG - Intronic
957347348 3:78979211-78979233 TGACCACTCATTTATGGAAGGGG - Intronic
971262021 4:25065881-25065903 TATCCATCCATTTAGGGGAGGGG + Intergenic
977436390 4:97001295-97001317 TGTCCCCTCATTTACATGTGTGG + Intergenic
981917175 4:150047132-150047154 AGTCCAATCATTTATGAGAGAGG + Intergenic
986978043 5:13415252-13415274 TGTGCATTGATTTATGGGAGTGG - Intergenic
995567192 5:113443157-113443179 TGTCCTCTCATTTCCTTGAGTGG + Intronic
1009665872 6:66678798-66678820 TGTCCACTCATTTACTGCTTGGG - Intergenic
1014508459 6:122289785-122289807 TGTCAAATCATTCACTGGAGAGG - Intergenic
1016499752 6:144706372-144706394 AGTCCTCTTATTTACGGTAGAGG + Intronic
1020153610 7:5703161-5703183 TGAGGACTCATTTACTGGAGTGG - Intronic
1024461262 7:49661937-49661959 TGTGCAGTCATTTAGGGCAGTGG - Intergenic
1033911082 7:146263816-146263838 TGTTCACCCATTTAAGGGACAGG + Intronic
1042982494 8:74546277-74546299 TGTCTACTCATTTAGGGCATTGG + Intergenic