ID: 1171371467

View in Genome Browser
Species Human (GRCh38)
Location 20:24665081-24665103
Sequence GGCCCCAAGGGAATAAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 12, 3: 17, 4: 256}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171371467_1171371471 7 Left 1171371467 20:24665081-24665103 CCTTCTCTTATTCCCTTGGGGCC 0: 1
1: 0
2: 12
3: 17
4: 256
Right 1171371471 20:24665111-24665133 AAAGAAGTCTGTCTTCCCTGCGG 0: 1
1: 0
2: 1
3: 34
4: 327
1171371467_1171371478 27 Left 1171371467 20:24665081-24665103 CCTTCTCTTATTCCCTTGGGGCC 0: 1
1: 0
2: 12
3: 17
4: 256
Right 1171371478 20:24665131-24665153 CGGTGTGGGGGAGCAGCAGCAGG 0: 1
1: 0
2: 3
3: 24
4: 367
1171371467_1171371473 13 Left 1171371467 20:24665081-24665103 CCTTCTCTTATTCCCTTGGGGCC 0: 1
1: 0
2: 12
3: 17
4: 256
Right 1171371473 20:24665117-24665139 GTCTGTCTTCCCTGCGGTGTGGG 0: 1
1: 0
2: 2
3: 7
4: 172
1171371467_1171371475 15 Left 1171371467 20:24665081-24665103 CCTTCTCTTATTCCCTTGGGGCC 0: 1
1: 0
2: 12
3: 17
4: 256
Right 1171371475 20:24665119-24665141 CTGTCTTCCCTGCGGTGTGGGGG 0: 1
1: 0
2: 1
3: 21
4: 214
1171371467_1171371472 12 Left 1171371467 20:24665081-24665103 CCTTCTCTTATTCCCTTGGGGCC 0: 1
1: 0
2: 12
3: 17
4: 256
Right 1171371472 20:24665116-24665138 AGTCTGTCTTCCCTGCGGTGTGG 0: 1
1: 0
2: 1
3: 9
4: 173
1171371467_1171371474 14 Left 1171371467 20:24665081-24665103 CCTTCTCTTATTCCCTTGGGGCC 0: 1
1: 0
2: 12
3: 17
4: 256
Right 1171371474 20:24665118-24665140 TCTGTCTTCCCTGCGGTGTGGGG 0: 1
1: 0
2: 3
3: 28
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171371467 Original CRISPR GGCCCCAAGGGAATAAGAGA AGG (reversed) Intronic
900179554 1:1305227-1305249 AGCCCCTTGGGAACAAGAGAGGG - Intronic
900405032 1:2489180-2489202 GGCCCCAAGGCAGAAAGAGCAGG - Intronic
900581845 1:3413314-3413336 GGCCCCGGGGGAATCAGAGAAGG + Intronic
904030825 1:27532460-27532482 GGCTTCAAGGGAATCAGAGTGGG - Intergenic
905015932 1:34778425-34778447 GCGCCCAAGGGGATGAGAGATGG + Intronic
905238425 1:36566192-36566214 GGGCCCAAGGGAATCTGAGCAGG - Intergenic
906836419 1:49087008-49087030 ATCACCAAGGGCATAAGAGAAGG + Intronic
907976283 1:59434491-59434513 GGGCCCAAGGGAACTAGAGAGGG + Intronic
908014540 1:59816987-59817009 TGCCCCAGAGGAATAAGAGTTGG - Intronic
908433900 1:64085979-64086001 GGCATCCAGGGAATAAGGGATGG - Intronic
910748466 1:90600330-90600352 CGGCTCAAGGAAATAAGAGAGGG + Intergenic
911176235 1:94820596-94820618 GGCCCCAAGGTACTAAGCGGGGG - Intronic
912516479 1:110219667-110219689 GGGGCCAAGGGAAGAAGAGGTGG - Intronic
912574007 1:110647883-110647905 GGCCTTCAGGAAATAAGAGAGGG - Intergenic
914406768 1:147382739-147382761 AGCTCCAAGAGAGTAAGAGAAGG + Intergenic
914826166 1:151139292-151139314 GGCCACAGGGGAAAATGAGAAGG - Intronic
915095506 1:153459630-153459652 GTTCCCAAGGGAATACAAGAAGG - Intronic
915857131 1:159400651-159400673 GGCCCCAATACAATAAGAGCTGG + Intergenic
916676175 1:167065944-167065966 GGTCCCCGGGGAACAAGAGAAGG + Intronic
917068328 1:171122270-171122292 GACCCCAAGCGAAGAAGTGAGGG + Intergenic
922803999 1:228376511-228376533 GGGCTCAAGGGAGGAAGAGAGGG + Intronic
924862767 1:247942884-247942906 GGACCCCAGGGAATGGGAGAAGG - Intronic
1063003357 10:1945344-1945366 GGCCCCCAGGGAATGAGAGCAGG + Intergenic
1066662851 10:37753401-37753423 GGCCCCAAGGGCACATGAGGAGG - Intergenic
1067509012 10:46879625-46879647 GGCCCCAAGGGAGTGAGCAAAGG - Intergenic
1067653239 10:48172225-48172247 GGCCCCAAGGGAGTGAGCAAAGG + Intronic
1067960947 10:50848784-50848806 GGACCCAAGGGAACAGGAGCAGG - Intronic
1071271175 10:84009034-84009056 GGCCTCAAGGGAGTATGAGTGGG - Intergenic
1071812309 10:89196971-89196993 TGCCCAAAGGGTATAAGGGAAGG - Intergenic
1072713792 10:97736134-97736156 AGCCCTAAGGAAATAAGAGTTGG + Intergenic
1072844225 10:98811099-98811121 GGTCCTAAGGCAGTAAGAGAAGG - Intronic
1073689325 10:105790217-105790239 TTCCCCAAGGGAATAAGACCTGG + Intergenic
1074525881 10:114262854-114262876 GGCTCCAGGGGAAGAAGAAAAGG - Intronic
1074570700 10:114621600-114621622 AGTCCCAAGGGAATCAGAAAAGG - Intronic
1075528408 10:123204975-123204997 GGACACAAGGGAATAAGATGCGG - Intergenic
1076011004 10:126988205-126988227 TGCCCCGAGGGAATACGAAATGG - Intronic
1076361463 10:129892258-129892280 GCCCCCAAGGAAACAGGAGAGGG + Intronic
1078891180 11:15560360-15560382 AGCCCCCAGGGAAAAAGAGGTGG - Intergenic
1079332153 11:19542404-19542426 GGCCCCAAGGCAGTAAATGATGG + Intronic
1080156640 11:29118782-29118804 GGGACGAAGGGAAGAAGAGAGGG + Intergenic
1080850385 11:36063417-36063439 GGTTCCCAGGGACTAAGAGAGGG - Intronic
1083300217 11:61736158-61736180 GGCCCAAAGGGAAAAATGGATGG + Intronic
1083625557 11:64070304-64070326 GGCCCCCAGGGAACATGAGGAGG - Intronic
1084636990 11:70399002-70399024 GGGTCCGAGGGAATAGGAGAGGG + Intronic
1085622713 11:78049612-78049634 AGCCCCAAGGGAAGAATAGGGGG - Intronic
1086436697 11:86788289-86788311 GGCACCAAGAGAAGCAGAGAGGG + Intergenic
1088338243 11:108732702-108732724 GGCACAAAGGCAGTAAGAGATGG + Intronic
1088397404 11:109383556-109383578 GCGCCTAAGGGAATATGAGATGG - Intergenic
1088707343 11:112475747-112475769 GGCTCCCAGGGAACATGAGAGGG - Intergenic
1091590467 12:1839753-1839775 GACCCCAAGGCAATAGGAGACGG + Intronic
1091771132 12:3152076-3152098 TTCCCCAAGGGAATGAGAGCTGG - Intronic
1092686328 12:11051170-11051192 GGATCCAAGGGAAAAATAGATGG + Intronic
1094168669 12:27468119-27468141 GGCCCCCAGACAATAAGATAAGG + Intronic
1094593524 12:31843417-31843439 GGGCCCATAGGAAAAAGAGAAGG - Intergenic
1096759850 12:53832056-53832078 GGCCTCAATGGAATAAAAGTAGG - Intergenic
1098428590 12:70393995-70394017 GGCCTCCAGAGTATAAGAGAAGG - Intronic
1099882487 12:88483452-88483474 GGCCCCAATGCAATAATAGCTGG + Intergenic
1101399603 12:104376065-104376087 GGTCCCAAGGGATTCAGACAAGG + Intergenic
1101657760 12:106738333-106738355 GACTCAAAGGGAATAAGGGATGG + Intronic
1102643802 12:114389962-114389984 TGCCCCAAGGAAAGAAGAAAAGG + Intronic
1103727549 12:123005552-123005574 TGCCCCATGGGGATCAGAGAGGG + Intronic
1105208007 13:18239214-18239236 TGCACAAAGGCAATAAGAGAGGG - Intergenic
1105907928 13:24832704-24832726 GGCCCCAAGGGTTTTAGATAGGG + Intronic
1106099539 13:26682561-26682583 GTCACCAAGGGAACAAGAGAGGG - Intronic
1106113555 13:26797805-26797827 GGGCCCCAGGGTAGAAGAGAGGG + Intergenic
1106149065 13:27080337-27080359 GGCTACAGGGGAATAAGATATGG + Intronic
1106161112 13:27202171-27202193 GGCCACATGGGGACAAGAGAGGG - Intergenic
1106504022 13:30355788-30355810 GTCCCCCAGGGAATAAGAAAAGG - Intergenic
1110727708 13:78844356-78844378 AGCACCATGGAAATAAGAGAAGG - Intergenic
1112301964 13:98239200-98239222 AGCCCCAAGGGAACAAGTGCCGG + Intronic
1112898135 13:104326608-104326630 GGCCCCCAAGGAATTATAGAAGG + Intergenic
1113881387 13:113628704-113628726 GGCCCCTAGGGAAAAAAAGGAGG - Intronic
1114739333 14:25079119-25079141 GACCCCAAGTGAAGGAGAGAAGG - Intergenic
1117909012 14:60618746-60618768 GGCCCCAAAGAAATATCAGAGGG + Intergenic
1121380175 14:93458556-93458578 GGCTCCATAGGAATGAGAGATGG + Intronic
1121865710 14:97360372-97360394 CTGCCCAAGGAAATAAGAGAGGG - Intergenic
1121948996 14:98152717-98152739 TCCCCTAAGTGAATAAGAGAGGG + Intergenic
1122062266 14:99143917-99143939 GGCCCCAAGGGCACAAGACTTGG - Intergenic
1123163068 14:106298755-106298777 CTGCCCAAGGAAATAAGAGAGGG - Intergenic
1124890430 15:33727079-33727101 GGACCCAGGGGAAAACGAGAAGG - Intronic
1126840113 15:52709664-52709686 GGCACTAAGGAGATAAGAGATGG - Intronic
1127142492 15:55992415-55992437 GACACCAAGGTACTAAGAGAAGG + Intronic
1127250214 15:57227067-57227089 GGTACCAAGGGATGAAGAGATGG - Intronic
1128211518 15:65906501-65906523 GGCTCCAAGGGTATAGGATAAGG + Intronic
1128747004 15:70121765-70121787 GGCCCCAAGGATGTAAGAGTGGG - Intergenic
1128982254 15:72196690-72196712 GGCTCCTAGGGAACGAGAGAGGG - Intronic
1129720144 15:77873429-77873451 GGTCCCAAGGGAAGGGGAGAAGG - Intergenic
1129888052 15:79052459-79052481 GGCACAAAGGGAAACAGAGATGG - Intronic
1130530212 15:84741474-84741496 GGCCCGAAGGGGCAAAGAGATGG - Intergenic
1131666970 15:94581077-94581099 CGCACAAAGGGAAAAAGAGATGG + Intergenic
1131757006 15:95575583-95575605 GCCCCAAGGGGATTAAGAGATGG + Intergenic
1132367793 15:101270116-101270138 GGCCCCTGGGGAAGAAGGGACGG - Intergenic
1132390636 15:101435950-101435972 GGCCCACAGGGAAGAAGACAGGG - Intronic
1132394577 15:101463395-101463417 GGCCCCAAAGGAAGAGGGGAGGG - Intronic
1135390856 16:22092169-22092191 GAACCCAAGGGAATCTGAGAAGG + Intergenic
1136054501 16:27678419-27678441 GGCCAGAAGGGAAAAGGAGAGGG - Intronic
1136772242 16:32851002-32851024 CTGCCCAAGGAAATAAGAGAGGG + Intergenic
1136898369 16:34010519-34010541 CTGCCCAAGGAAATAAGAGAGGG - Intergenic
1137542262 16:49372778-49372800 GGCCCAAATGGATTAAGATAAGG - Intergenic
1139581019 16:67873582-67873604 GGCCCCAGCGGATTCAGAGAAGG - Intronic
1140687715 16:77449700-77449722 GACCCCAAGTGAAGGAGAGAGGG + Intergenic
1141063591 16:80896802-80896824 GGACCCAAGGGCATGAGAGAGGG + Intergenic
1141198952 16:81882660-81882682 GGCCTCGAGGAAAAAAGAGAAGG - Intronic
1141446635 16:84062987-84063009 GGCCCCAAGGAAGTCAGGGAAGG + Intronic
1141742546 16:85903627-85903649 GCCCCCAAAGGAATGACAGATGG - Intronic
1141886420 16:86895427-86895449 TGCCCCAAGGGAAAAAGGAAGGG - Intergenic
1203074664 16_KI270728v1_random:1113091-1113113 CTGCCCAAGGAAATAAGAGAGGG + Intergenic
1143054463 17:4152448-4152470 GGCCTCAAGGGAAAACAAGATGG + Intronic
1143328561 17:6117881-6117903 GGCATCAGGGGCATAAGAGAGGG - Intronic
1143515549 17:7417701-7417723 GGCCCGAAGGGATGAAGGGAGGG - Exonic
1143730871 17:8881998-8882020 GGGCCCTGGTGAATAAGAGAGGG - Intronic
1145301838 17:21646311-21646333 GGCCCCAAGGGAAGGAGAGAGGG + Intergenic
1145328178 17:21849057-21849079 GGCCCCAAGGGAAGGAGAGAGGG + Intergenic
1145348474 17:22057008-22057030 GGCCCCAAGGGAAGGAGAGAGGG - Intergenic
1145415109 17:22708347-22708369 GGCCCAAAGGGAAGGAGAGAGGG + Intergenic
1145694964 17:26780404-26780426 GGCCCCAAGGGAAGGAGAGAGGG + Intergenic
1148490932 17:48023765-48023787 GGCCCCAAGTGTATAAGGGAAGG - Intergenic
1150212925 17:63451303-63451325 GGGCCCAAGGGAATGGGACATGG + Intergenic
1150587338 17:66530921-66530943 GGCCCCCAGGGTATAAGAGAAGG - Intronic
1152153623 17:78618423-78618445 CGCCCCAAGGGAAGAACCGAGGG - Intergenic
1203192788 17_KI270729v1_random:205245-205267 GGCCCCAAGGGAAGGAGAGAGGG + Intergenic
1203202152 17_KI270730v1_random:4680-4702 GGCCCCAAGGGAAGGAGAGAGGG + Intergenic
1153285586 18:3451941-3451963 GGCCTCCCGGGAATAAGTGAGGG + Exonic
1153438433 18:5090742-5090764 GGGCCAAAAGGAATAAAAGATGG + Intergenic
1153816042 18:8791126-8791148 AGCTCCAAGGGAACAGGAGATGG + Intronic
1154020504 18:10660507-10660529 GGGAACAAGGGAAAAAGAGAGGG - Intergenic
1155251773 18:23959554-23959576 AGGCCCAAGGGAATAAGGGGTGG - Intergenic
1156754619 18:40507006-40507028 GGCCACAATGGAATAAATGAAGG + Intergenic
1157307918 18:46530377-46530399 GGCCTCAAGGGTAGAACAGAGGG + Intronic
1157472780 18:48002909-48002931 GGCCCTAGGGAAACAAGAGAGGG - Intergenic
1157604972 18:48920673-48920695 GGCAGGAAGGGAATAAGACAAGG + Exonic
1157732309 18:50014764-50014786 GGCCCCAAGGGAATGAAGGTGGG + Intronic
1162966995 19:14160729-14160751 GAGCCAAAGGGAAGAAGAGAAGG + Intronic
1163404240 19:17112583-17112605 GGTCCCAAGGGAGGAGGAGAGGG + Intronic
1163460648 19:17435564-17435586 GGGCTCAAGGAAATAACAGAGGG - Exonic
1163612424 19:18308361-18308383 GTCCCCAAGGGAGACAGAGAGGG - Intronic
1164533338 19:29064652-29064674 AGCCCCGAGGGCATGAGAGATGG + Intergenic
1165488185 19:36108053-36108075 GGCCACAAGGCACAAAGAGAAGG + Intergenic
1165955313 19:39498860-39498882 GGCCCCAAGGGACCAAGGGCGGG - Intergenic
1166813192 19:45526406-45526428 GGCCCCAAGGGGATGGCAGAGGG - Exonic
1166966358 19:46531507-46531529 GGCCCCAAGGGAAGCAGGGTGGG + Intronic
1168072216 19:53959575-53959597 GGCCCCAAGGGAGTGAGGGTCGG - Intergenic
926308291 2:11656359-11656381 GGCCCCAAGGGTTTCAGATAAGG - Intergenic
926656452 2:15412382-15412404 GTCCCCAAATGAATAAGACATGG + Intronic
927982002 2:27380324-27380346 GGCACTAAGGGAATCAGAGTGGG - Intronic
930718944 2:54620281-54620303 AGCCCCAAGGGAATAGAGGAGGG + Intronic
930948148 2:57101579-57101601 GGCCCCAATACAATAATAGATGG - Intergenic
931746364 2:65294905-65294927 TGGCTCAAGGGAATAAAAGAGGG + Intergenic
931997561 2:67853782-67853804 GGCCACAAGCAAATAAGAGTTGG - Intergenic
932864437 2:75326837-75326859 TGACCCAAGGGAATAAGGGAAGG + Intergenic
935487535 2:103675870-103675892 GGCAACAAGGAAAAAAGAGATGG + Intergenic
936794718 2:116191094-116191116 GGCCCCAATATAATAAGAGCTGG - Intergenic
939319262 2:140595147-140595169 TGCCCAAAGGGAATAAAATAAGG + Intronic
939402262 2:141709716-141709738 GGCTCCAAGGGAAAAAGAGATGG + Intronic
944423530 2:199556266-199556288 TGTCCCAAGGTAAGAAGAGAGGG - Intergenic
944794383 2:203167845-203167867 GACCTCAAGTGAATGAGAGAGGG - Intronic
945386978 2:209212849-209212871 GGCCCAAAGGGAAAGAGAGAGGG + Intergenic
945972864 2:216247203-216247225 TGCACCAAGGGAAAAGGAGATGG - Intergenic
948152190 2:235753082-235753104 ACCCCCAGGGGAATAAGAGGTGG - Intronic
948769032 2:240238492-240238514 GACACCAAGTGAATCAGAGATGG - Intergenic
1169265780 20:4166673-4166695 GACACCAAGGGAAACAGAGATGG + Intronic
1169547512 20:6665682-6665704 GGCAGGAAGGGAAGAAGAGATGG - Intergenic
1171371467 20:24665081-24665103 GGCCCCAAGGGAATAAGAGAAGG - Intronic
1171518413 20:25757699-25757721 GGCCCCAAGGGAAGGAGAGAGGG + Intergenic
1171558442 20:26098507-26098529 GGCCCCAAGGGAAGGAGAGAGGG - Intergenic
1172134723 20:32679290-32679312 GGCCCCCAGGCAGTAAGAGTAGG + Intergenic
1172767635 20:37359195-37359217 GGCCCCACAGGAATAAGAGGTGG - Intronic
1172880379 20:38195834-38195856 ACCCCCAAGGGAATGAGAGGAGG + Intergenic
1173169915 20:40715674-40715696 GGCCCCAGGGGCCTAAAAGAAGG + Intergenic
1173313675 20:41923977-41923999 GGCCATAAAGGAATTAGAGAAGG - Intergenic
1174398629 20:50263657-50263679 GTCACCAAGGGAAAAAAAGAAGG + Intergenic
1174528364 20:51191491-51191513 GGCACCAAGGGAAGCAGGGAAGG - Intergenic
1176295618 21:5070519-5070541 GGCCCCAAGGGACCCAGACAAGG - Intergenic
1176652567 21:9564113-9564135 GGCCCCAAGGGAAGGAGAGAAGG + Intergenic
1179861431 21:44191605-44191627 GGCCCCAAGGGACCCAGACAAGG + Intergenic
1180758573 22:18181103-18181125 TGCACAAAGGCAATAAGAGAGGG - Intergenic
1180768860 22:18364895-18364917 TGCACAAAGGCAATAAGAGAGGG - Intergenic
1180777452 22:18497500-18497522 TGCACAAAGGCAATAAGAGAGGG + Intergenic
1180810172 22:18754810-18754832 TGCACAAAGGCAATAAGAGAGGG + Intergenic
1180826735 22:18868119-18868141 TGCACAAAGGCAATAAGAGAGGG - Intergenic
1181196316 22:21189062-21189084 TGCACAAAGGCAATAAGAGAGGG + Intergenic
1181213211 22:21304062-21304084 TGCACAAAGGCAATAAGAGAGGG - Intergenic
1181395491 22:22618392-22618414 AGCCCCAAGGGACACAGAGAGGG - Intergenic
1182296291 22:29312529-29312551 GGCCACAAAGGAAAAGGAGAAGG - Exonic
1182656371 22:31893539-31893561 GGCCCCAAGAGAGTGAGAAAAGG - Intronic
1184325011 22:43776225-43776247 GGCCCAATGGGAAGAGGAGAAGG + Intronic
1184920030 22:47599607-47599629 AGCCCCAAGGAAATTAGAGGAGG - Intergenic
1203230482 22_KI270731v1_random:105779-105801 TGCACAAAGGCAATAAGAGAGGG - Intergenic
1203276876 22_KI270734v1_random:94029-94051 TGCACAAAGGCAATAAGAGAGGG - Intergenic
950265884 3:11572540-11572562 TGCCCCAGGGGACGAAGAGAGGG - Intronic
953696137 3:45161157-45161179 GGCAGGAAGGGAAGAAGAGATGG - Intergenic
953890133 3:46745094-46745116 AGCCCCAAGGCAAGCAGAGAAGG + Intronic
954940878 3:54372069-54372091 GGCCCCAAGGGCCTCAGAGATGG + Intronic
958721084 3:97844506-97844528 GTCAACAAGGGATTAAGAGATGG - Intronic
960142209 3:114161765-114161787 GGAACCAAGAGAATAAAAGAAGG + Intronic
961328865 3:126127398-126127420 GGCCCCAAGGGAGGGAGGGACGG - Intronic
962997964 3:140650659-140650681 TGCCGCCAGGGAATGAGAGAGGG - Intergenic
963448352 3:145443302-145443324 GGCCCCAATACAATAATAGATGG + Intergenic
964551164 3:157886287-157886309 GTCACCAAGGGAAAAAAAGATGG - Intergenic
968952846 4:3703516-3703538 GGCATCATGGGAAGAAGAGAGGG + Intergenic
968956264 4:3721378-3721400 AGCCCCACGGGAATGACAGACGG - Intergenic
971114682 4:23631061-23631083 GGTCCCATAGGAATAAGAGTAGG - Intergenic
972378719 4:38498881-38498903 GTCCCCAAGAGAAAAAGAGTTGG - Intergenic
973706510 4:53586128-53586150 GGCCTCAAGGGAAAAAAAAAAGG + Intronic
977689851 4:99894232-99894254 GGCCCAAAGAAAAGAAGAGAGGG + Intronic
980188560 4:129494244-129494266 GGCCCCAAAAGAAAAGGAGATGG - Intergenic
980775943 4:137436601-137436623 GTCCCCTATGAAATAAGAGAAGG - Intergenic
981269544 4:142829095-142829117 GTGCCCAAAGAAATAAGAGACGG + Intronic
989697496 5:44220350-44220372 AGCCGCAAGGGCATAATAGAGGG - Intergenic
990275239 5:54188526-54188548 GTCCTCAAGGGAATTAGACATGG + Intronic
995299526 5:110561872-110561894 GGTTCCAAGAGAATAAGAGAGGG + Intronic
997851331 5:137335337-137335359 GGCTTCAGAGGAATAAGAGAAGG + Intronic
998369548 5:141651913-141651935 GGCCCAAAGGGAAAAAGACTTGG + Intergenic
999699058 5:154211345-154211367 ATCACCAAGGGAAAAAGAGAGGG - Intronic
999933122 5:156455505-156455527 GGGGCCAAGGGAAGGAGAGAGGG - Intronic
1000673075 5:164086708-164086730 GGGCCCAAGGGAAAGAGTGAAGG + Intergenic
1000781411 5:165487082-165487104 GGCTGAAAGGGAATGAGAGATGG + Intergenic
1001155967 5:169272732-169272754 AGCTCCCAGGGAAAAAGAGATGG + Intronic
1001686528 5:173598059-173598081 GGCTCCTTGGGAATAGGAGAGGG - Intergenic
1002402788 5:179001137-179001159 GGGCCCTCAGGAATAAGAGAAGG + Intergenic
1004005846 6:11636669-11636691 GGCCCACAGGCAATAGGAGATGG - Intergenic
1006459480 6:34150081-34150103 GGCCCCAAGGGTCTCAGATAAGG + Intronic
1006918644 6:37613335-37613357 GGGCCCAGGGGAGTCAGAGAGGG - Intergenic
1007085431 6:39141051-39141073 GGCTCCTAGGGAATAAGGTAGGG + Intergenic
1007368763 6:41412790-41412812 GACCCCAGGGGCTTAAGAGAGGG - Intergenic
1007412671 6:41673972-41673994 GGCCCCCAGGGAACAGGAGCAGG + Intergenic
1009356383 6:62752197-62752219 TTCACCAATGGAATAAGAGAAGG + Intergenic
1011740426 6:90354220-90354242 GGCACAAAGGGCATGAGAGATGG - Intergenic
1013374406 6:109500661-109500683 GGCCCCAAGGGTCTTAGATAAGG - Intronic
1016017407 6:139200187-139200209 GGCCGCAAGTGTAGAAGAGAGGG - Intergenic
1017910683 6:158790025-158790047 GGCACCAAGGAAGTCAGAGAAGG + Intronic
1019912538 7:4109561-4109583 GGACCCAAGGGACACAGAGAAGG - Intronic
1021971180 7:25967347-25967369 GGGAACAAGGGAAGAAGAGAGGG + Intergenic
1022355701 7:29612456-29612478 GACCCAGAGAGAATAAGAGAAGG - Intergenic
1022918263 7:34983534-34983556 GGCAAGAAGGGAAGAAGAGAGGG + Intronic
1023020119 7:36004371-36004393 GGCAGAAAGGGAATAAGAGATGG - Intergenic
1023715776 7:43042789-43042811 GGACACAAGGGGACAAGAGAAGG + Intergenic
1023728850 7:43170822-43170844 GACCCCAAGGAAATCAGAGTTGG + Intronic
1024550180 7:50556167-50556189 AGCCCAAAGGGACTAAGATAGGG - Intronic
1027229002 7:76261441-76261463 GGCCCCACGGGAGGAAGAGGAGG - Intronic
1029599050 7:101553248-101553270 GGCCCCCAGGGAACTGGAGAGGG + Intronic
1030599315 7:111574842-111574864 GACCCCAAGGCAATAATAGCTGG + Intergenic
1031083182 7:117278005-117278027 GGCCCCCAGGGAGGAAGAGGGGG + Exonic
1031445115 7:121844547-121844569 GGCTACAAGTGAATAATAGATGG - Intergenic
1031761507 7:125718100-125718122 GTCCAAAAGGGAAAAAGAGATGG + Intergenic
1032695634 7:134333802-134333824 GGCCTGAAGGGACAAAGAGAGGG - Intergenic
1034263997 7:149772796-149772818 GGCCCCGAGGGGAGGAGAGAGGG - Intronic
1040514619 8:48124685-48124707 GGCCCCAAGAGAAGGAGAGGAGG + Intergenic
1041423170 8:57692346-57692368 GGGCCCAATGTAAGAAGAGAGGG - Intergenic
1043554218 8:81411516-81411538 GGCCCCACTGCAATAAGAGCTGG + Intergenic
1045290357 8:100827613-100827635 GACCCAAAGGGAGGAAGAGAGGG + Intergenic
1045434292 8:102145247-102145269 AGCCCAAAAGGACTAAGAGAAGG - Intergenic
1045674363 8:104590528-104590550 GACCACAAGGGAATAAAAGCTGG - Intergenic
1045921208 8:107531635-107531657 GTCCCAAAGGTAATAAGTGATGG - Intergenic
1047241180 8:123089985-123090007 GGCCCCAAGGGTTTCAGAAAAGG + Intronic
1048733556 8:137471791-137471813 GGCCTAAAGGAAATAAGAGTGGG - Intergenic
1048745265 8:137607637-137607659 GGCCCCCAGGAAAAAAGAGTAGG - Intergenic
1050265240 9:3882732-3882754 GGCCCCATGAGAACAAGAAAGGG + Intronic
1050637841 9:7630999-7631021 GTGCTCAAGGAAATAAGAGAGGG + Intergenic
1053455691 9:38231707-38231729 GGCCTGAAGGGGCTAAGAGAAGG - Intergenic
1060376864 9:123123144-123123166 GGGCCCAAGTGAATAATAAATGG + Exonic
1060681526 9:125569161-125569183 GCCCCCAAGGGCATAAAACAAGG - Intronic
1061077012 9:128347938-128347960 GGCAGCCAGGGAAGAAGAGAGGG + Intronic
1061132278 9:128714738-128714760 GGCCTGAAGGGAAAGAGAGAAGG + Intronic
1062025102 9:134336586-134336608 GGCCCCACGGGAAGAGGAGCAGG - Intronic
1203630296 Un_KI270750v1:67654-67676 GGCCCCAAGGGAAGGAGAGAAGG + Intergenic
1186948463 X:14595734-14595756 GGCCCCAAGGGAGTAATTAAAGG + Intronic
1187076277 X:15938439-15938461 GACCCCGAGTGAAGAAGAGAGGG - Intergenic
1188611075 X:32098708-32098730 AGCCCCGGGAGAATAAGAGAAGG - Intronic
1189611295 X:42739006-42739028 GGTGCCAAGGAAATAAGACATGG + Intergenic
1190121037 X:47659249-47659271 GGGCCAAAGGGGAGAAGAGAAGG + Intergenic
1190687356 X:52887220-52887242 GTCCACCAGGGAATCAGAGATGG + Intergenic
1190698626 X:52968572-52968594 GTCCACCAGGGAATCAGAGATGG - Intronic
1190964563 X:55286610-55286632 GGCCCCAATAAAATAATAGATGG - Intronic
1194520626 X:94914770-94914792 GACCCCAATAGAATAATAGATGG + Intergenic
1194619406 X:96150802-96150824 TGCCTCACGGGAATAAGTGAAGG + Intergenic
1195411119 X:104568268-104568290 GACCCCAAGGAAGTAAGGGAGGG + Intronic
1195851829 X:109291742-109291764 GGCCCCAATACAATAATAGATGG - Intergenic
1196552406 X:117044966-117044988 GGCTGCAAGGGGATAAGGGAAGG - Intergenic
1197435434 X:126422413-126422435 GGCCCCAATACAATAAGAGTTGG - Intergenic
1197612326 X:128653319-128653341 GGCCCAAATGGACTAAGACAAGG + Intergenic
1197635245 X:128907414-128907436 GGCCCAAAAGGAATAAGAAAAGG - Intergenic
1197986477 X:132271171-132271193 GAGCCCTAGGGAAGAAGAGAAGG - Intergenic
1198676178 X:139133632-139133654 AGCCCCCAGTGAATATGAGAAGG - Intronic
1199804003 X:151279728-151279750 GGCCCCTAGGGACTCAGAGAGGG - Intergenic
1200042489 X:153380085-153380107 GGCCTCAAGAGAGAAAGAGATGG + Intergenic