ID: 1171371735

View in Genome Browser
Species Human (GRCh38)
Location 20:24666764-24666786
Sequence CTGTGTCCACTGAGGGGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 212}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171371735_1171371741 0 Left 1171371735 20:24666764-24666786 CCTAATCCCCTCAGTGGACACAG 0: 1
1: 0
2: 2
3: 20
4: 212
Right 1171371741 20:24666787-24666809 AGACCCCCTCTCCAGGACGGTGG 0: 1
1: 0
2: 1
3: 16
4: 277
1171371735_1171371739 -7 Left 1171371735 20:24666764-24666786 CCTAATCCCCTCAGTGGACACAG 0: 1
1: 0
2: 2
3: 20
4: 212
Right 1171371739 20:24666780-24666802 GACACAGAGACCCCCTCTCCAGG 0: 1
1: 1
2: 0
3: 21
4: 305
1171371735_1171371746 9 Left 1171371735 20:24666764-24666786 CCTAATCCCCTCAGTGGACACAG 0: 1
1: 0
2: 2
3: 20
4: 212
Right 1171371746 20:24666796-24666818 CTCCAGGACGGTGGCTCCACCGG 0: 1
1: 0
2: 1
3: 26
4: 163
1171371735_1171371740 -3 Left 1171371735 20:24666764-24666786 CCTAATCCCCTCAGTGGACACAG 0: 1
1: 0
2: 2
3: 20
4: 212
Right 1171371740 20:24666784-24666806 CAGAGACCCCCTCTCCAGGACGG 0: 1
1: 0
2: 2
3: 34
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171371735 Original CRISPR CTGTGTCCACTGAGGGGATT AGG (reversed) Intergenic
900111181 1:1006243-1006265 CTGGGTCCACTGTGTGGAGTGGG + Intergenic
901154959 1:7129449-7129471 CTGTCACCACTGAGGGGAGGGGG + Intronic
902103682 1:14015362-14015384 CTAGGTCCACTGAGGGAATGTGG - Intergenic
902629722 1:17697387-17697409 CTGTGCCCTCTGAGGGGAGAGGG - Exonic
905501415 1:38441913-38441935 CTGTGTCCATTGCAGGGGTTGGG - Intergenic
905990542 1:42334505-42334527 CTGTGTCCTTTGCTGGGATTAGG - Intronic
907297980 1:53467655-53467677 CTTTATCAAGTGAGGGGATTGGG + Intergenic
910140050 1:84017093-84017115 CTATGTCCTTTGGGGGGATTTGG - Intergenic
912614377 1:111083199-111083221 CTGTGTCTATTGAGATGATTAGG + Intergenic
915104853 1:153527442-153527464 CTGTGTCTGCTGAGGGACTTGGG - Intergenic
915276778 1:154794486-154794508 CTGAGTCCTCTGATGGGATCAGG + Intronic
915963931 1:160290284-160290306 CTGTGCCCATTGAGGGGTATAGG - Intronic
916021898 1:160799826-160799848 CTGTGTCTACTGAGATGTTTAGG - Exonic
918171754 1:182004175-182004197 CTGTGGCCACTGTGGGGATGGGG - Intergenic
918822316 1:189270697-189270719 CTGTGGCAACTGAGGGTATCAGG - Intergenic
921124558 1:212165930-212165952 CTCTGTCCACTGAGAGGACAGGG - Intergenic
923800550 1:237204987-237205009 CTGTGTCCTCTCAGGGCAGTGGG - Intronic
924661121 1:246018108-246018130 CTGTGTCCACTGAGAGGACCTGG - Intronic
924721840 1:246630566-246630588 CTGTTTCCCCTGAGGGATTTGGG + Intronic
1062830068 10:599641-599663 CTCTGTCCACTGAGGGTGCTGGG - Intronic
1063465802 10:6243523-6243545 CTGCCTCCACTGATGGGACTAGG - Intergenic
1064535118 10:16350338-16350360 CTCTGTCCACTGAGGCAACTAGG + Intergenic
1066441105 10:35439861-35439883 CTGTTGACACTGAGGGGATGTGG + Intronic
1066663387 10:37758483-37758505 CTCTGTCCACTGAGGGGGCATGG - Intergenic
1073150216 10:101306224-101306246 CTCTGGCCAATGAGGGGAGTTGG + Intergenic
1073817590 10:107224502-107224524 CTGTGTGCACTCTAGGGATTTGG - Intergenic
1075271356 10:121054491-121054513 CCATGTACCCTGAGGGGATTGGG + Intergenic
1080731124 11:34954363-34954385 CTGTGTACACAGATGAGATTAGG + Intronic
1082001572 11:47395976-47395998 CTTTGTCCACTGAGGGGCCTTGG - Intergenic
1082874364 11:57972825-57972847 CTGTGTATGCTGAGGGGAGTGGG + Intergenic
1085284357 11:75350459-75350481 CTGTGCCCACTTAGGGGGTGGGG + Intronic
1089218591 11:116851764-116851786 CAGTGCCCACTGAGAGGAATTGG - Intronic
1090441929 11:126731357-126731379 CTGTGTCCACTGTTTGCATTGGG + Intronic
1091380786 12:57198-57220 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1093800744 12:23369325-23369347 CTTTGTCCACTGAGAAGACTTGG + Intergenic
1095250828 12:39977677-39977699 TTGTGACCACTGAGGATATTCGG - Intronic
1097280822 12:57844928-57844950 CTCGTTCCACTGAGGGAATTTGG + Intronic
1099502060 12:83426179-83426201 CTGGGGCCACTCAGGGGGTTGGG - Intergenic
1102654626 12:114471515-114471537 CTGTCTACACAGAGGTGATTTGG + Intergenic
1102962340 12:117100714-117100736 CGGTGCCCACAGAGGGGACTCGG + Intergenic
1104103295 12:125635446-125635468 TTGTGTCCATTGAAGGGATATGG - Intronic
1104567564 12:129899065-129899087 CTGTGTTCACTGAAGGCATGTGG + Intronic
1104745670 12:131208685-131208707 CTGTGTCCAGTGTGGGCATGAGG + Intergenic
1105836568 13:24217329-24217351 CTGTGGCCACTGATGCTATTAGG - Intronic
1106402442 13:29443323-29443345 CTGTGTCCCCTGATGCAATTGGG + Intronic
1107361150 13:39618940-39618962 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1107702053 13:43058476-43058498 CTGTGGCCACTGTGGGGTATGGG + Intronic
1107824163 13:44312465-44312487 CTCTGTCCACTGGGGGGATTGGG - Intergenic
1108640762 13:52380469-52380491 CAGCTTCCACTGAGAGGATTGGG - Intronic
1109259656 13:60129128-60129150 GTGTGTCCACTGAGTGTTTTTGG - Intronic
1113892474 13:113743670-113743692 CAGTGTCCACTGTGGGGCTCAGG - Intergenic
1116023076 14:39484822-39484844 CTGTGTCCACTGATGGGACCAGG + Intergenic
1116211187 14:41946923-41946945 TTGTGTCCATTGAGGTAATTAGG - Intergenic
1119435885 14:74597607-74597629 CTTTGTCCAACGAGGTGATTAGG - Intronic
1119484879 14:74980795-74980817 CTGTGTGCGCTGATGGGATTAGG - Intergenic
1122384532 14:101334883-101334905 CTGTCTCCACTCTGGGGAGTTGG - Intergenic
1124254170 15:28127543-28127565 CTTTGTCCACTGAGGAGGTCTGG + Intronic
1127003141 15:54533807-54533829 ATGTGTCCACAGTTGGGATTGGG + Intronic
1127853820 15:62938604-62938626 CTCTGTACACTGAAGGAATTGGG - Intergenic
1128635133 15:69298333-69298355 CTGTGTCCACTGAGTGGCAGAGG + Intergenic
1129227565 15:74178971-74178993 CTGGGTCCACTGAGGGGCTGGGG - Intergenic
1129713501 15:77833541-77833563 GTGGGCCCACTGAGGGGGTTAGG + Intergenic
1130549163 15:84878810-84878832 CTGTGTCCCCTGAGGCCCTTTGG - Intergenic
1135207208 16:20493372-20493394 CTGGGTCAACTGAGGGTATCTGG + Intergenic
1135211677 16:20530260-20530282 CTGGGTCAACTGAGGGTATCTGG - Intergenic
1135742142 16:24985069-24985091 CTGTGTCCCCAGAGGACATTTGG + Intronic
1135996864 16:27256763-27256785 CTGTGTCAGCTGAAGGCATTTGG - Intronic
1139436332 16:66938682-66938704 CTGTGTCCACTGACAGGACCAGG + Intronic
1142629559 17:1215905-1215927 CTGTGTCCACTCAGGGTAAATGG + Intronic
1143245096 17:5477862-5477884 CTCTGTTCACTGAGAGGATCTGG + Intronic
1143308968 17:5972498-5972520 CTGTTCCCACTGTGGGGATGAGG - Intronic
1145805027 17:27720489-27720511 CTGGGTCCAGTGGGGGGACTTGG + Intergenic
1146507073 17:33414603-33414625 ATGTGCCCACTGAGGCCATTGGG + Intronic
1147529732 17:41264447-41264469 CTGTTTTCAGTGAGGGAATTAGG - Intergenic
1147924656 17:43938917-43938939 TTGTTTTCACTGAGGGGATGAGG - Exonic
1148846983 17:50535098-50535120 CTGTGGCTACTGGGGGGAATTGG + Intronic
1152500231 17:80703344-80703366 CTGTGTTCACTAAGGGGAAGTGG + Intronic
1153533106 18:6069585-6069607 CTGCGGCCACTGTGAGGATTGGG + Intronic
1157090129 18:44627225-44627247 CCCTTTGCACTGAGGGGATTTGG + Intergenic
1160479678 18:79227342-79227364 CTCTGTTCACTGCAGGGATTTGG - Intronic
1161296772 19:3524121-3524143 CTGTGTGCACAGAGAGGATCTGG + Intronic
1161478236 19:4498062-4498084 CTGAGTTCACTGAGGGGAACGGG + Intronic
1162368044 19:10261303-10261325 CTATGTCCACTGAGGGTGTTTGG - Intergenic
1162811236 19:13165326-13165348 CTGTGTAAACAGAGGGGACTTGG - Intergenic
1165137887 19:33681842-33681864 CTGCTTCCACTGAGGGTTTTGGG + Intronic
1165389455 19:35529946-35529968 CCGGGTCCTCTGAGGGGAGTGGG - Intergenic
1165721334 19:38081859-38081881 CTGTGTCCTGGGAGGGGCTTGGG - Exonic
1165771472 19:38383029-38383051 CTGGGTCAACTGTGAGGATTTGG - Intronic
1166447552 19:42871481-42871503 CTGTGAACACAGTGGGGATTTGG - Intronic
1168239259 19:55081181-55081203 CTGGGTCCACTGAGGGGTCCAGG - Intronic
925273606 2:2633281-2633303 CTCTGTGCACTGATGGGATGAGG + Intergenic
926195607 2:10761962-10761984 CTGTGTCCACTTAGTGCATGTGG + Intronic
928228390 2:29475327-29475349 CTGTGTTACCTGAGGGGATGTGG - Intronic
929768536 2:44871258-44871280 TTGTGGCCACTGAGGAGATTGGG - Intergenic
932281819 2:70499397-70499419 CTGTGTCCACTGCGGGCCCTGGG - Intronic
933754667 2:85628838-85628860 CTTTAACCACAGAGGGGATTAGG - Intronic
933915686 2:86990933-86990955 CTGTGTTCACTTAGGGTTTTTGG + Intronic
934007307 2:87778969-87778991 CTGTGTTCACTTAGGGTTTTTGG - Intronic
934564957 2:95333743-95333765 CTGCGTTCAGTGAGGGAATTGGG - Intronic
934717200 2:96550939-96550961 CTGTGTCCACTCAGAGGACAGGG + Intronic
935230636 2:101092852-101092874 CTCTGTACACTGAGGGGACCTGG - Intronic
935770948 2:106419882-106419904 CTGTGTTCACTTAGGGTTTTTGG - Intronic
935800655 2:106691848-106691870 CTTTGTCCACTGGAGGGATTTGG + Intergenic
935909132 2:107876055-107876077 CTGTGTTCACTTAGGGTTTTTGG + Intronic
935995807 2:108771489-108771511 CTGTGTTCACTTAGGGTTTTTGG + Intronic
936130915 2:109841192-109841214 CTGTGTTCACTTAGGGTTTTTGG + Intronic
936213782 2:110530293-110530315 CTGTGTTCACTTAGGGTTTTTGG - Intronic
936422920 2:112384853-112384875 CTGTGTTCACTTAGGGTTTTTGG - Intronic
937250237 2:120519252-120519274 CTGTGTCCACTTAGTAGATAGGG - Intergenic
937442721 2:121930656-121930678 GTGTGTCCACTGAGTGACTTAGG + Intergenic
938973675 2:136455663-136455685 CTCTGTCCACTGAGTGGGTCTGG - Intergenic
939839034 2:147164958-147164980 CAGTGTCCATGGAGGGGGTTGGG + Intergenic
940172370 2:150843051-150843073 CTGGGGCTACTGTGGGGATTGGG + Intergenic
940387518 2:153090791-153090813 CTGTGGCTACTGTGGGGAATGGG + Intergenic
940492551 2:154382153-154382175 CTGTGTCCATAGAGGGGATTGGG - Intronic
942358422 2:175145149-175145171 CTGTGTCCACTGAGAGGGCCTGG + Intronic
942496713 2:176547695-176547717 CAGAGTCCACTGGGGGTATTAGG - Intergenic
943374249 2:187055317-187055339 CTTTGTCCCCAGAGGGGATTTGG + Intergenic
943770817 2:191714376-191714398 GTGTGTTTACTGAGGGGTTTAGG - Intergenic
946452852 2:219795797-219795819 CTGGGTCCAGGGAGGGGATCAGG + Intergenic
1171371735 20:24666764-24666786 CTGTGTCCACTGAGGGGATTAGG - Intergenic
1171474279 20:25395952-25395974 CTGGGTCCACGGAGGGGGGTAGG + Intergenic
1172846595 20:37933348-37933370 CTGTATCCACTCAGGGGAGGAGG - Intronic
1172973154 20:38888161-38888183 TAGTGTCCACGGTGGGGATTAGG + Intronic
1173021623 20:39272313-39272335 CTGGGTCCTCTGAGTGGATTTGG + Intergenic
1173860039 20:46277372-46277394 CTGTGTCCACAGAGAGGACAAGG - Intronic
1174395824 20:50246391-50246413 CTGTGCCCACTGACCGGTTTTGG + Intergenic
1175108124 20:56628761-56628783 CTGTGCCCACGGAGGGAACTGGG + Intergenic
1175264789 20:57696024-57696046 CTGTGACCAGTGAGGTGCTTGGG - Intronic
1179447929 21:41446321-41446343 CTGTGTCCTCTCATGGGATAAGG + Intronic
1181469094 22:23127100-23127122 CTGTTGCCACTGTGGGGATCTGG - Intronic
1181797961 22:25323701-25323723 CTGTGTCTAATAAGGGGAGTTGG - Intergenic
1182959851 22:34461952-34461974 CTCTGTCCACTGAGAAGATCTGG - Intergenic
1183316476 22:37139794-37139816 CTGTGTGCATTGAGGGGCTAAGG - Intronic
1183408209 22:37640531-37640553 CTGGGTCCAGGGAGGGGACTGGG + Intronic
1185334636 22:50266068-50266090 CTGTTTCCCCTGCAGGGATTGGG + Intronic
951548280 3:23851152-23851174 CTGTCTCCATTGAGCTGATTTGG + Intronic
952590176 3:34942877-34942899 CTGTGTCCAATGAGTGAGTTTGG - Intergenic
953665868 3:44926134-44926156 CCGTGTCCACTTGGGGGATGAGG + Exonic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
961376465 3:126469406-126469428 GTGTGTCAGCTGAGTGGATTTGG - Intronic
961591809 3:127986876-127986898 ATGTGTCCATTGAGGGCATCGGG - Exonic
966592444 3:181697311-181697333 TTCTTTCCACTGAGGGGTTTTGG - Intergenic
968487629 4:871548-871570 CTGTGTTCACTGTGGGGCTGGGG + Intronic
969312859 4:6364205-6364227 AGGTGTCCACTGAGTGGATGAGG + Intronic
969549169 4:7852944-7852966 CTGTCTCCTCTGCGGGGAGTTGG + Intronic
970367442 4:15374113-15374135 CTGTGTCCACTGTAGGGAGGTGG - Intronic
971606250 4:28661618-28661640 CTGTATCCCCAGAGGGGAGTAGG - Intergenic
973140839 4:46766008-46766030 CTGTGTCCACTGAGTGGACCTGG - Intronic
978716019 4:111843256-111843278 CTGTGTTGACTGAGTGAATTTGG - Intergenic
981442544 4:144799445-144799467 CTGTGGCCACTGTGGGGGATGGG + Intergenic
981813170 4:148798694-148798716 CTGATTCCACAGAGGGCATTGGG + Intergenic
981968552 4:150636607-150636629 CTTTGTCCACTGAGGGGGCCTGG - Intronic
982488779 4:156001955-156001977 CTGGGTCGAGTGAGGGGACTTGG + Intergenic
985701838 5:1378167-1378189 CTGTGTCCACTGGGGGACCTCGG - Intergenic
987612736 5:20228077-20228099 GTGTTTCCATTAAGGGGATTGGG - Intronic
987946111 5:24610736-24610758 CTATGTGCACTGAGGGGATAGGG + Intronic
988886384 5:35563066-35563088 CTGTGTGCACTGTAGGGACTTGG + Intergenic
988889451 5:35599016-35599038 CTGTGGCCACTGAGGGGGAAGGG - Intergenic
991341219 5:65612166-65612188 TTGTGTAAAGTGAGGGGATTTGG - Intronic
992350647 5:75925400-75925422 CTGAGTCCTATGAGGGTATTGGG - Intergenic
993549768 5:89259302-89259324 CTGTGTCCACCCAGGGGAAGTGG - Intergenic
993803218 5:92371389-92371411 CTGTGTTCAGTGACGGGATAGGG - Intergenic
995041738 5:107595674-107595696 TTGTGGACACTGAGGGGAATGGG - Intronic
995120159 5:108527582-108527604 CTGTGCCCATTGAGTGAATTGGG + Intergenic
995962733 5:117863136-117863158 CTATGTCTACTGAGGGAACTAGG - Intergenic
996141348 5:119913372-119913394 CTGTGGCCACTGTGGGGGATGGG + Intergenic
996609016 5:125357632-125357654 CTGTGGCCACTGTGGGGGATGGG + Intergenic
997474483 5:134134651-134134673 CTGTGACCAATGAGGTGAGTAGG + Intronic
997774154 5:136584413-136584435 TTTTGGCCTCTGAGGGGATTGGG + Intergenic
999712837 5:154333514-154333536 CTATGTACACTGAGGAAATTGGG - Intronic
999930984 5:156432637-156432659 CTGTGGCCACTGTGGGGGATAGG + Intronic
1003429529 6:6026183-6026205 CTGATTCCTCTGGGGGGATTGGG + Intergenic
1004031073 6:11870110-11870132 CTGTGTTCACATTGGGGATTAGG - Intergenic
1006415749 6:33902963-33902985 CTGTGAGCCCAGAGGGGATTGGG - Intergenic
1006716720 6:36125056-36125078 AAGTGTCCCCTGAGGGGTTTGGG + Intergenic
1007582031 6:42965506-42965528 CAGGGTCCACTGAGGAGAATGGG - Intronic
1007629076 6:43262846-43262868 CTGTGTCCACTGACAGCATCTGG - Exonic
1008185896 6:48389585-48389607 CTGTGGCCACTGTGGGGGATGGG + Intergenic
1009935184 6:70225370-70225392 CTGTGTCAACTGAGGTGACAGGG - Intronic
1011114621 6:83876255-83876277 CTTTGCACACTGTGGGGATTGGG + Intronic
1012141473 6:95631504-95631526 CTGTGTGCAGTCAGGGGATTTGG + Intergenic
1012869824 6:104659489-104659511 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1012983446 6:105853369-105853391 CTGTGTCCACTCAGGGTAAATGG - Intergenic
1015772723 6:136785524-136785546 CTGTGTCCACTGAAGGAGTGAGG + Intronic
1015927374 6:138323694-138323716 CTGTGTTCACTGAGGAGATGTGG + Exonic
1018961059 6:168448664-168448686 CTGTCTCCACTGAGGCAATGAGG + Intronic
1019748719 7:2715309-2715331 CGGCGTTCACTGTGGGGATTTGG + Exonic
1021824157 7:24531412-24531434 CTGAGTCCACTGAGTAGACTTGG - Intergenic
1022039635 7:26567751-26567773 CTGTGTCCATTGAGGCTTTTAGG - Intergenic
1022469027 7:30670629-30670651 CTGTGGCCAATGAGGGCACTGGG + Intronic
1023673645 7:42606539-42606561 CTGTGTCCCTTGATGGGATTCGG - Intergenic
1028348844 7:89818495-89818517 CTTTGTCCACTGAGAGGACCTGG - Intergenic
1029496443 7:100897415-100897437 CGGTGTCCAGGCAGGGGATTTGG - Intergenic
1032076941 7:128840534-128840556 CTGTGCCCTCTGAGGAGATGGGG - Exonic
1035204951 7:157289277-157289299 CTGTGTGAACTGAGGGAAGTCGG - Intergenic
1036022692 8:4863626-4863648 CTGTGTCCCCTGGGTGGATATGG - Intronic
1036165505 8:6429296-6429318 CTGTGTCCAATGGGGGCACTGGG - Intronic
1036981455 8:13474154-13474176 CTGTGTGCAGTCTGGGGATTTGG + Intronic
1039735298 8:40324916-40324938 CTCTGCCCACTGAGGGGCCTTGG - Intergenic
1040890107 8:52308659-52308681 CTGTGTCCAGGGAGGTGAGTGGG + Intronic
1041191308 8:55357953-55357975 CTGTGTCAACAAAGGGCATTAGG - Intronic
1044121769 8:88406077-88406099 CAGTGTCCTTTGAGGAGATTGGG + Intergenic
1046618136 8:116499794-116499816 CTGTGTGCAGTCTGGGGATTTGG - Intergenic
1047644645 8:126857233-126857255 TTGTGCACTCTGAGGGGATTGGG + Intergenic
1047784934 8:128144997-128145019 CTCTGAGCACTGGGGGGATTAGG + Intergenic
1048504974 8:135013007-135013029 CTATGTCCAGTCAAGGGATTTGG + Intergenic
1048743246 8:137585552-137585574 CTGTGCCAACTGAGGTGATGAGG - Intergenic
1049397494 8:142408092-142408114 ATGTGTCCACAGAGGGGAGTGGG - Intergenic
1050187085 9:2985968-2985990 CTGTGTTCACTGCGAGGAATTGG - Intergenic
1051365413 9:16318281-16318303 CTGTGTCCATTTAAGGGATGAGG - Intergenic
1051397091 9:16634843-16634865 CAGTGTACACTGAGGGGAGGGGG + Intronic
1051908701 9:22127617-22127639 CTGTGTCCACTGAGGATCTCTGG + Intergenic
1052758251 9:32564090-32564112 CTATGTCCACTGAGAGGACCTGG - Intronic
1053536276 9:38929548-38929570 CAGTGTTCACTGAGGGGATGGGG - Intergenic
1054629859 9:67434400-67434422 CAGTGTTCACTGAGGGGATGGGG + Intergenic
1055613874 9:78051359-78051381 CTAGGTCCTCTGAGGGGACTTGG - Intergenic
1056737678 9:89223792-89223814 CTGTGTCCACAGTGTGCATTTGG - Intergenic
1056762761 9:89426697-89426719 TTGTGGCCTCTGAGGGGCTTTGG - Intronic
1057212462 9:93207564-93207586 CTGTCTCCAGTGAGTGTATTTGG + Intronic
1058784576 9:108374610-108374632 CTGTGGCTACTGTGGGGAATAGG + Intergenic
1060343581 9:122797734-122797756 GTATGATCACTGAGGGGATTGGG + Intergenic
1061631582 9:131875447-131875469 CCGTGTCCACTGTGGAGATATGG + Intronic
1062527556 9:136984452-136984474 GGGTGGCCACTCAGGGGATTGGG + Intronic
1187055142 X:15735713-15735735 CAGTTTCCATTGAGGGGATTTGG + Intronic
1192252307 X:69422711-69422733 CTGTGTCCACTCAGGGTAAATGG + Intergenic
1194379473 X:93176040-93176062 CTGGGGCAACTGAGGGTATTTGG + Intergenic
1195614643 X:106902850-106902872 CTGAGTCCCCTGAGGGGGATGGG - Intronic
1199586832 X:149423645-149423667 CTGTGGCCACTGTGGGGGATGGG - Intergenic
1199866972 X:151860664-151860686 CTGTGTCCACAGAAGGGCTCAGG + Intergenic
1200359774 X:155592506-155592528 CTGTGCCAACTTAGGGGAGTAGG - Intronic
1201774178 Y:17646022-17646044 CTGTGTCCTCTGTGGGGCTCTGG + Intergenic
1201827379 Y:18259967-18259989 CTGTGTCCTCTGTGGGGCTCTGG - Intergenic
1202353296 Y:24017891-24017913 CTGGGTCCAATGAGGGGGGTAGG + Intergenic
1202517483 Y:25652224-25652246 CTGGGTCCAATGAGGGGGGTAGG - Intergenic