ID: 1171374284

View in Genome Browser
Species Human (GRCh38)
Location 20:24681709-24681731
Sequence ACACTGACCCAGCCAGCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171374275_1171374284 28 Left 1171374275 20:24681658-24681680 CCACAGGTCCTGCAGAATAGAGC No data
Right 1171374284 20:24681709-24681731 ACACTGACCCAGCCAGCCTCAGG No data
1171374279_1171374284 5 Left 1171374279 20:24681681-24681703 CCTGCCTCAGCCTGTGGACAAGC No data
Right 1171374284 20:24681709-24681731 ACACTGACCCAGCCAGCCTCAGG No data
1171374278_1171374284 6 Left 1171374278 20:24681680-24681702 CCCTGCCTCAGCCTGTGGACAAG No data
Right 1171374284 20:24681709-24681731 ACACTGACCCAGCCAGCCTCAGG No data
1171374280_1171374284 1 Left 1171374280 20:24681685-24681707 CCTCAGCCTGTGGACAAGCCCAT No data
Right 1171374284 20:24681709-24681731 ACACTGACCCAGCCAGCCTCAGG No data
1171374281_1171374284 -5 Left 1171374281 20:24681691-24681713 CCTGTGGACAAGCCCATCACACT No data
Right 1171374284 20:24681709-24681731 ACACTGACCCAGCCAGCCTCAGG No data
1171374276_1171374284 20 Left 1171374276 20:24681666-24681688 CCTGCAGAATAGAGCCCTGCCTC No data
Right 1171374284 20:24681709-24681731 ACACTGACCCAGCCAGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171374284 Original CRISPR ACACTGACCCAGCCAGCCTC AGG Intergenic
No off target data available for this crispr