ID: 1171375914

View in Genome Browser
Species Human (GRCh38)
Location 20:24694082-24694104
Sequence TGGATTTGTACCCAGGGGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171375904_1171375914 6 Left 1171375904 20:24694053-24694075 CCCAAACCTCGTGGCACAGAAAA No data
Right 1171375914 20:24694082-24694104 TGGATTTGTACCCAGGGGGTTGG No data
1171375906_1171375914 0 Left 1171375906 20:24694059-24694081 CCTCGTGGCACAGAAAAGACCCA No data
Right 1171375914 20:24694082-24694104 TGGATTTGTACCCAGGGGGTTGG No data
1171375903_1171375914 7 Left 1171375903 20:24694052-24694074 CCCCAAACCTCGTGGCACAGAAA No data
Right 1171375914 20:24694082-24694104 TGGATTTGTACCCAGGGGGTTGG No data
1171375901_1171375914 20 Left 1171375901 20:24694039-24694061 CCTCTTGGGAGTACCCCAAACCT No data
Right 1171375914 20:24694082-24694104 TGGATTTGTACCCAGGGGGTTGG No data
1171375905_1171375914 5 Left 1171375905 20:24694054-24694076 CCAAACCTCGTGGCACAGAAAAG No data
Right 1171375914 20:24694082-24694104 TGGATTTGTACCCAGGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171375914 Original CRISPR TGGATTTGTACCCAGGGGGT TGG Intergenic
No off target data available for this crispr