ID: 1171378281

View in Genome Browser
Species Human (GRCh38)
Location 20:24710699-24710721
Sequence GGAGTTTTAGTACATTCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171378276_1171378281 0 Left 1171378276 20:24710676-24710698 CCCTCTTAAAGTGTACAATTCAC No data
Right 1171378281 20:24710699-24710721 GGAGTTTTAGTACATTCACGGGG No data
1171378277_1171378281 -1 Left 1171378277 20:24710677-24710699 CCTCTTAAAGTGTACAATTCACG No data
Right 1171378281 20:24710699-24710721 GGAGTTTTAGTACATTCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171378281 Original CRISPR GGAGTTTTAGTACATTCACG GGG Intergenic
No off target data available for this crispr