ID: 1171378453

View in Genome Browser
Species Human (GRCh38)
Location 20:24713014-24713036
Sequence ATAAACTTAAGGTAAAGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1838
Summary {0: 188, 1: 446, 2: 399, 3: 274, 4: 531}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171378453_1171378462 28 Left 1171378453 20:24713014-24713036 CCACCCCTTTACCTTAAGTTTAT 0: 188
1: 446
2: 399
3: 274
4: 531
Right 1171378462 20:24713065-24713087 AAAGGCAGCAGATACTTGGTTGG No data
1171378453_1171378461 24 Left 1171378453 20:24713014-24713036 CCACCCCTTTACCTTAAGTTTAT 0: 188
1: 446
2: 399
3: 274
4: 531
Right 1171378461 20:24713061-24713083 TCTTAAAGGCAGCAGATACTTGG No data
1171378453_1171378458 -5 Left 1171378453 20:24713014-24713036 CCACCCCTTTACCTTAAGTTTAT 0: 188
1: 446
2: 399
3: 274
4: 531
Right 1171378458 20:24713032-24713054 TTTATGAGACCTTATATGTTAGG No data
1171378453_1171378460 10 Left 1171378453 20:24713014-24713036 CCACCCCTTTACCTTAAGTTTAT 0: 188
1: 446
2: 399
3: 274
4: 531
Right 1171378460 20:24713047-24713069 ATGTTAGGCGAGTCTCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171378453 Original CRISPR ATAAACTTAAGGTAAAGGGG TGG (reversed) Intergenic
900030105 1:365026-365048 AAAAACTTAATGGAAAGAGGAGG - Intergenic
900050757 1:594090-594112 AAAAACTTAATGGAAAGAGGAGG - Intergenic
901189409 1:7398465-7398487 ATAAACTGAAAGTAAAGGGATGG - Intronic
902892549 1:19454935-19454957 ATAAACTCTTGGTAAAGGGAAGG + Intronic
902969380 1:20035580-20035602 TTAAACTTAAGGTATAGGGGTGG - Intronic
903752375 1:25633639-25633661 ATAAACTCAAAGTAAAGGGGTGG - Intronic
904572298 1:31475680-31475702 ATAAACTTAAGTTAAAGGGGTGG - Intergenic
905101657 1:35528962-35528984 ATAGACTGAAAGTAAAGGGATGG - Intronic
905497613 1:38405542-38405564 ATAAACATAAGGTAAAGGGATGG + Intergenic
905964309 1:42078588-42078610 ATAGGCTGAAGGTAAAGGGATGG - Intergenic
906053770 1:42898136-42898158 ATAAACTTAAAGTAAAAGGGTGG - Intergenic
906314133 1:44775511-44775533 AACAACGTAAAGTAAAGGGGCGG + Exonic
906563808 1:46781795-46781817 ATAAACTTAAAGTAAATGGGTGG - Intronic
906869360 1:49460450-49460472 ATAAATCTAAGGAAAAGGGCTGG - Intronic
906910712 1:49945839-49945861 ATAAACTGAAAGTAAAGAGGTGG + Intronic
906914848 1:49997335-49997357 AAAAACTCAAGGTAAAGGGATGG + Intronic
907349356 1:53813408-53813430 ATAAACTTAAAGTAAAAGGGTGG + Intronic
907474460 1:54696281-54696303 AAAAACTAAAAGGAAAGGGGAGG - Intronic
907633587 1:56109211-56109233 ATAAACTTCAGGTAAAGAGATGG + Intergenic
907887196 1:58604114-58604136 TCAAACTTAAGGTAAAGGGTTGG - Intergenic
908174905 1:61545853-61545875 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
908453880 1:64282725-64282747 AGCAACTTAAGGAAAAGGGAGGG + Intergenic
908660489 1:66430065-66430087 ATAAACTTAAGGAAAAGGGATGG - Intergenic
908803439 1:67904993-67905015 ATAAGCTTAAGGTAAAGGGGTGG - Intergenic
908862130 1:68500900-68500922 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
908883627 1:68761387-68761409 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
908890594 1:68843354-68843376 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
908981986 1:69969410-69969432 ATAAACTTAAGGTAAAGGGATGG + Intronic
909173574 1:72324890-72324912 AGAAATTTAAGAAAAAGGGGTGG + Intergenic
909178674 1:72392251-72392273 ATAAACTCAAAATAAAGGGATGG - Intergenic
909227841 1:73047548-73047570 ATAAAGTCAAGGGAAAGGCGTGG + Intergenic
909405666 1:75286332-75286354 ATGAACTTAAGGTAAAGGGGTGG - Intronic
909420969 1:75464661-75464683 ATAAACTGAAAATAAAGGGATGG + Intronic
909511158 1:76454141-76454163 CTAAACTTAAGGTAAAGGGGTGG - Intronic
909712754 1:78671732-78671754 ACAGACTCAAGGTAAAGGGGTGG - Intergenic
909715241 1:78699940-78699962 ATAAGCTCAAAATAAAGGGGTGG - Intergenic
909828156 1:80152326-80152348 ATAAATTTAAGGTAAAGGGGTGG - Intergenic
909860272 1:80595972-80595994 GTAAACTTAAGGTAAAGGGGTGG + Intergenic
909981188 1:82103421-82103443 ATAAACTTAAAGTAAATGGGTGG - Intergenic
910077806 1:83300833-83300855 ATAAACTTCAAGTAAAGGGGTGG + Intergenic
910323674 1:85978500-85978522 ATAAACCTAAGGTAAAAGGGTGG + Intronic
910598239 1:89003211-89003233 ATAAAGTTAAAGTAAATGGGTGG - Intergenic
911080914 1:93929505-93929527 ATAAACTTAAAGTTAAGGGGTGG + Intergenic
911265690 1:95740962-95740984 ATAAACTTAAGGTACAGTGGTGG - Intergenic
911318057 1:96378426-96378448 ATAAACTTAAGGTAAAAGAGTGG + Intergenic
911322514 1:96432517-96432539 AAAAACTTAAGGTAAAGGGAGGG - Intergenic
911562230 1:99419872-99419894 ATAAACTTAAGAAAAAGAGTTGG + Intergenic
911678708 1:100689904-100689926 ATAAACTTAAAGTAGAAAGGTGG - Intergenic
911679096 1:100693452-100693474 ATAAACTTAAGGTAAAGGTGTGG - Intergenic
911689339 1:100814287-100814309 ATAAACTTAAGGTAAAGGGATGG + Intergenic
911743463 1:101412877-101412899 ATAAAATTAAGGCAAAGGGGTGG + Intergenic
911763982 1:101651834-101651856 ATAAACTGAATGTAAGGGGATGG - Intergenic
911805993 1:102209279-102209301 CTAAACTTAAGGTAAAGAGGTGG - Intergenic
911835706 1:102616238-102616260 ATAAGCTCAAAGTAAAGGGATGG + Intergenic
912108342 1:106308793-106308815 ATAAATTTAAAGTCAAGGGATGG + Intergenic
912144510 1:106775858-106775880 ATAAACTGAAAGTAATGGGATGG + Intergenic
912612261 1:111060217-111060239 ATAAATTTAAGGAAAAGGAGTGG - Intergenic
913035615 1:114962521-114962543 ATAAACTTAAGGTAAAGGGGTGG - Intronic
913151558 1:116048880-116048902 ATAAACTTAAGGTAAAGGGGTGG + Intronic
913155141 1:116089725-116089747 ATGAACTCAAGGTAAAGGTGTGG - Intergenic
913236379 1:116787185-116787207 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
913337303 1:117720548-117720570 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
913383601 1:118235461-118235483 ATGAAGTTAAGGTAAAGGGGTGG + Intergenic
913417979 1:118633599-118633621 ATATAGTTAAGGTAAAGGGATGG - Intergenic
913493714 1:119407011-119407033 ATAAACTTAGGGTAAAGGGGTGG + Intergenic
913548145 1:119890269-119890291 ATCAGCTGAAAGTAAAGGGGTGG + Intergenic
913588005 1:120295260-120295282 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
913620180 1:120603109-120603131 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
914455285 1:147831032-147831054 ATAAACTTAAAGCAAAGGGGTGG - Intergenic
914570021 1:148907133-148907155 ATAAACTTAAGGTAAAGGGGTGG - Intronic
914602808 1:149223136-149223158 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
915800897 1:158792255-158792277 ATAGGCTCAAGGTAAAGGGGTGG - Intergenic
915999742 1:160604059-160604081 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
916566160 1:165980468-165980490 ATGAACATAAGGTAAAGGTGTGG - Intergenic
916580126 1:166099551-166099573 ATAAAGTTAAATTAAAGGGGTGG + Intronic
916603651 1:166319261-166319283 ATAAATTAAAAGTAAAGGGATGG - Intergenic
916617939 1:166462951-166462973 ATACACTGAAAGTAAAGGGATGG - Intergenic
916686884 1:167155767-167155789 AGAAACATAAAGTAAAGGTGCGG - Intergenic
916872971 1:168937689-168937711 AAAAACCTAAGGTAAAGGGGTGG - Intergenic
917057700 1:171002102-171002124 ATAAACTTAAAGTAAAGGCATGG - Intronic
917096864 1:171406970-171406992 ACTGAGTTAAGGTAAAGGGGTGG + Intergenic
917351400 1:174081897-174081919 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
917461782 1:175236724-175236746 ATAAACTTAAAGTATAGGGGTGG + Intergenic
917573079 1:176290410-176290432 ATAAACTCAAGTTAAAGGGGTGG + Intergenic
917746717 1:178016588-178016610 GTAAATTCAAGGTAAAGGGGTGG - Intergenic
917907793 1:179605234-179605256 CATAACTTAAAGTAAAGGGGTGG - Intronic
917913456 1:179676213-179676235 AGAAACTTAAGGTAAAGAGATGG - Intronic
918718461 1:187822255-187822277 ATACACTTAAGATAAAGGGGTGG - Intergenic
918721647 1:187859835-187859857 ATAAACTTAAGGTAAAGAGATGG - Intergenic
918806379 1:189051730-189051752 ATAAACTCAAAGTAAAGTGATGG - Intergenic
918873679 1:190010169-190010191 ATGAACTTAAAATAAAGGGGTGG + Intergenic
919115315 1:193274323-193274345 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
919214287 1:194532689-194532711 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
919249551 1:195035006-195035028 ACAGACTCATGGTAAAGGGGTGG - Intergenic
919278617 1:195455306-195455328 ATAGACTGAAAGTGAAGGGGTGG - Intergenic
919287832 1:195587271-195587293 ATAAACTAAAAATAAAGGGATGG + Intergenic
919485483 1:198141436-198141458 ATAAACTTAAGGTAAGGGGGTGG - Intergenic
919492012 1:198215687-198215709 ATGGACTTAAGGTAAAGGAGTGG + Intronic
919590563 1:199496457-199496479 ATAGACTGAAAGTAAAAGGGTGG + Intergenic
920726767 1:208443591-208443613 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
920800126 1:209178884-209178906 ATAAACTTAAGGTAAGTGAGTGG + Intergenic
920990020 1:210927839-210927861 ATAAACTTAAGGTAAAGGGGTGG + Intronic
921042946 1:211451401-211451423 ATAAACTGAAAATAAAGGGATGG + Intergenic
921196633 1:212763563-212763585 AAAAATTTAAGGTAAAGGGGTGG + Intronic
921241162 1:213185245-213185267 ATAGACTGAAAGTGAAGGGGTGG - Intronic
921242307 1:213197813-213197835 ATAAATTTAAGGAAAAGGGATGG - Intronic
921532695 1:216305372-216305394 ATAAACTTAAGGTAAAGAGGTGG - Intronic
921762699 1:218935446-218935468 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
921999975 1:221467203-221467225 ATAAACTTAAGGTAAAGGGTTGG - Intergenic
922094059 1:222426327-222426349 ATAGATTCAAGGTAAAGGAGTGG + Intergenic
922377495 1:224983311-224983333 ATAAACTTAAAGTAAAGGGGTGG - Intronic
922395809 1:225200193-225200215 ATAAACTTAAGATAAAGGGGTGG - Intronic
923122454 1:231004764-231004786 ATAAACTTAAGGCAAAGGGGTGG + Intergenic
923458941 1:234190348-234190370 ATAAACTTAAGGTAAAGGGGTGG + Intronic
923691738 1:236200703-236200725 ATAAACTTAAGGTAAAGGGGTGG - Intronic
923808443 1:237286666-237286688 ATAAACTTAAAGTAAAGGGGTGG - Intronic
923960924 1:239083000-239083022 ATAAACTTAAGGTAAATGGGTGG - Intergenic
924492047 1:244547921-244547943 ATAAACTGAAAGTAAAGGGATGG + Intronic
924691738 1:246358094-246358116 ATAAACTTAAGGTAAAGGGGTGG + Intronic
924767805 1:247050389-247050411 ATAAACCTAAGGTAAAGAGGTGG - Intronic
924829784 1:247581257-247581279 ATAAACTTAAGGTAAAGGAGTGG + Intergenic
924877972 1:248126903-248126925 ATAAACTTAATATAAAGGGGTGG - Intergenic
924883096 1:248185043-248185065 ATAAACTTAAGATAAAGGGGTGG - Intergenic
924894348 1:248319196-248319218 ATAAACTTACTATAAAGGGGTGG + Intergenic
924930090 1:248722953-248722975 ATAAACTTAAGGTAAAGCGGTGG + Intronic
1063404809 10:5783312-5783334 TCAAATTTAAGGTAAAGGGGTGG - Intronic
1063561100 10:7128685-7128707 ATAAACTTATGGTAAAGGGGTGG - Intergenic
1064557021 10:16557579-16557601 ATAAACTTAAGGTAAATGGGTGG - Intergenic
1064700975 10:18021483-18021505 ATAGACTCAAAGTAAAGGGATGG - Intronic
1065158079 10:22891570-22891592 ATAGACTCAAGGTAAAGGGGTGG - Intergenic
1065355483 10:24836091-24836113 ATAAACTTAAGATAAAGGGGTGG + Intergenic
1065470754 10:26079359-26079381 ATAAACTTAAAGTAAAGGGGTGG - Intronic
1065571561 10:27075372-27075394 ATACTCTCAAGATAAAGGGGTGG + Intronic
1065894383 10:30150218-30150240 ATAAACTTAAGGTAGGGGGGTGG - Intergenic
1066097985 10:32091632-32091654 ATAGACTCAAGATAAAGGGTTGG - Intergenic
1066145332 10:32552260-32552282 ATAAACTTAAAGTAAATGGGTGG - Intronic
1066170548 10:32839287-32839309 ATAAACTTAAGGTAAAGGTGTGG + Intronic
1066420880 10:35263555-35263577 ATAAAATAAAGAAAAAGGGGAGG + Intronic
1066619389 10:37328174-37328196 TGAAACTTAAGGTAAAAAGGTGG + Intronic
1066651076 10:37655711-37655733 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1067234015 10:44432916-44432938 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1067675648 10:48373521-48373543 ATAAGCTCAAAATAAAGGGGTGG + Intronic
1067895192 10:50171516-50171538 ATAAACTCAAGGAAAAAGGGTGG + Intergenic
1067953793 10:50770460-50770482 ATAAACTCAAGGAAAAAGGGTGG - Intronic
1068023476 10:51614350-51614372 ATAAATTGAAAGTAAAGGGATGG - Intronic
1068157219 10:53215780-53215802 TTAAACTTAAGGTGAAGGGGTGG - Intergenic
1068314682 10:55324368-55324390 ATAGACTCAAAGTAAAGGGATGG + Intronic
1068340158 10:55690813-55690835 ATAAACTGAAAGTAAAGGGAAGG - Intergenic
1068383466 10:56291643-56291665 ATAGACTGAAAGTAAAGGGGTGG - Intergenic
1068808707 10:61229994-61230016 ATAAACTTAAGTTAAAGGGGTGG + Intergenic
1068954757 10:62812974-62812996 ATCAACCCAAGGCAAAGGGGAGG - Exonic
1069113086 10:64470420-64470442 AGAAACTTAAGGTAATGGGGTGG + Intergenic
1069146183 10:64894618-64894640 ATAAACTTAAGATAAAGGGGTGG - Intergenic
1069150309 10:64952104-64952126 ATGAACTTAAAGTAAAGGGGTGG - Intergenic
1069199916 10:65600511-65600533 ATAAACTTAAGGGAAAGAGGTGG - Intergenic
1069242507 10:66161042-66161064 ATAAACCTAAAGAAAAGGTGTGG - Intronic
1069562445 10:69440313-69440335 AGAAACTCAAGCTAAAAGGGTGG - Intergenic
1069648321 10:70021510-70021532 ATAAACTTAAGCTGAAGGAGTGG + Intergenic
1069899151 10:71697001-71697023 AAAAACCTAAGGGAAAGGTGAGG - Intronic
1070433859 10:76368962-76368984 ATAAACTTAAAGTGAAGGAGTGG - Intronic
1070465107 10:76713609-76713631 ATAAACTTAAAGTTAAGGGATGG + Intergenic
1071015682 10:80994940-80994962 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1071023993 10:81091060-81091082 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1071045777 10:81374687-81374709 AAAAACTTAAGCTAAAGGGGCGG - Intergenic
1071761484 10:88612514-88612536 AGAAACTCAAGGTAAAGCAGTGG + Intergenic
1071932816 10:90492459-90492481 ATAGACTCAAAGTAAAGGGATGG + Intergenic
1072056411 10:91761588-91761610 ACAAACTCAAAGTAAAGGAGTGG + Intergenic
1072164055 10:92794922-92794944 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1072769065 10:98122158-98122180 ATAAATTTAAGGTAAAGGTGTGG - Intergenic
1072928223 10:99635749-99635771 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1073701100 10:105927536-105927558 ATAAACTTAAGGTAAAGGACTGG + Intergenic
1073741894 10:106416821-106416843 ATAAACTTAAGGTAAAGGAATGG + Intergenic
1073900275 10:108213277-108213299 ACAAACTTGAGGTAAAAGGGTGG - Intergenic
1073905172 10:108271084-108271106 ATAAACTGAACATAAAGAGGTGG - Intergenic
1074037183 10:109752042-109752064 ATAAACTTAAGGTAAAGGAGTGG - Intergenic
1074466649 10:113689267-113689289 ATAGAATCAAGGTAAAGGGGTGG - Intronic
1074635532 10:115311967-115311989 ATAGACTCAAGGTAAAGGGGTGG - Intronic
1074985621 10:118656913-118656935 ATAAACTTAAAGTAAAGGCGTGG - Intergenic
1074986068 10:118660784-118660806 ATAAACTTAAGATAAAGGAGTGG - Intergenic
1075493984 10:122902353-122902375 ATAACCTTGAGGTAAAGGGATGG + Intergenic
1075660415 10:124191424-124191446 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1076112182 10:127869032-127869054 ATAGACTCAAGGTAAAGGGGTGG - Intergenic
1076376119 10:129986571-129986593 ATAAACTTCAGGTAAAGGGGTGG + Intergenic
1076665397 10:132086720-132086742 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1077774994 11:5260657-5260679 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1077834045 11:5908446-5908468 ATAAACTTAAGGTAAAGGAGTGG - Intronic
1078244321 11:9559934-9559956 ATAAACTGAAAATAAAGGGATGG - Intergenic
1078288796 11:9985233-9985255 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1078411748 11:11127634-11127656 ATCAACTCAAGGTAAAAGGGTGG - Intergenic
1079179700 11:18179538-18179560 ATAAACTTAAGGTAAAGGGTTGG + Intronic
1079255762 11:18828278-18828300 ATAAACTTAAAGTAAAGGGATGG - Intergenic
1079273462 11:19011415-19011437 ATAAACTTAAAGTAAAAGGGTGG - Intergenic
1079463985 11:20711243-20711265 ACTAACTAAAGGTAAAGGGGTGG - Intronic
1079487609 11:20951863-20951885 ATTACCTCAAGGTAAAGAGGAGG - Intronic
1079805834 11:24930091-24930113 ATAAACTTAAGGTAAGGGGGTGG - Intronic
1079856188 11:25608643-25608665 ATAAACTTAAGGTAAAGATGTGG - Intergenic
1079956301 11:26869627-26869649 ACAAACTTAAGATAAAGGGGTGG + Intergenic
1080203151 11:29697635-29697657 ATAGACTTAAGGTAAAGGGGTGG - Intergenic
1080324318 11:31052130-31052152 ATAAACATAAAGTAAAGGGGTGG + Intronic
1080402497 11:31949150-31949172 ATAAACTTATAGTAAATGGGTGG + Intronic
1080672344 11:34392915-34392937 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1080863885 11:36176158-36176180 ATAAACTTAAGGTAAAGGGGTGG - Intronic
1081090887 11:38865277-38865299 ATAAACTTCAGGTAAAGGGATGG - Intergenic
1081195449 11:40154492-40154514 ATAAACTTAAAGTAAAGGGGTGG + Intronic
1082104180 11:48202033-48202055 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1082111659 11:48283391-48283413 ATAAACTTAAGATGAACAGGAGG - Intergenic
1082679988 11:56155382-56155404 ATAAACATAAGGTAAAGGGGTGG + Intergenic
1082721419 11:56681756-56681778 ATAAACTGAAAAGAAAGGGGTGG + Intergenic
1082915469 11:58430046-58430068 ATAGACTGAAGGTAAACAGGTGG + Intergenic
1082917055 11:58448425-58448447 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1083005591 11:59342742-59342764 ATAATCTTAAGGGAAAATGGTGG - Intergenic
1083064380 11:59909200-59909222 AAAAACTTAAAGTAAAGGGGTGG - Intergenic
1083098027 11:60272741-60272763 ATCAACTTAAAGTAAAGGGATGG - Intergenic
1083385285 11:62304504-62304526 ATAGACTTAAAATAAAGGGATGG - Intergenic
1083946928 11:65928855-65928877 AAAAACGGAAGATAAAGGGGAGG - Intergenic
1085240332 11:75048306-75048328 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1085687424 11:78636274-78636296 ATAGACTGAAAGTGAAGGGGTGG + Intergenic
1085748064 11:79131816-79131838 ATAAATTTAAAGTAAAGGGGTGG + Intronic
1085917361 11:80905289-80905311 ACAAACTTAAGGTAAAGGGGTGG + Intergenic
1086082648 11:82921230-82921252 ATAAACATCAAGTAAAGGAGTGG - Intronic
1086264784 11:84984764-84984786 ATAAACTTAAGGTAAAGGGATGG + Intronic
1086297797 11:85390133-85390155 ATAAACTTAAGGTAAAGGGATGG + Intronic
1086315495 11:85587561-85587583 ACTCACTTAAGGTAATGGGGTGG - Intronic
1086553032 11:88074834-88074856 ATAGACTGAAAGTAAAGAGGTGG + Intergenic
1086740629 11:90363784-90363806 AAAAAATTAAGGTACATGGGTGG + Intergenic
1087227645 11:95620102-95620124 ATAGACTGAAAGTAAAGGGATGG + Intergenic
1087395487 11:97591307-97591329 ATAAATTTAAGGTAAAGGGGTGG + Intergenic
1087405483 11:97724353-97724375 ATAAACTTAAAGTAAAAAGGTGG + Intergenic
1087469064 11:98547811-98547833 ATAAACTTAAGGGAAAGAGGGGG + Intergenic
1087546434 11:99590040-99590062 ATGAACTTCAGGTATAGAGGAGG + Intronic
1087602256 11:100331111-100331133 ATAAACTTAAGGTAAAAAGGTGG + Intronic
1087616118 11:100488552-100488574 CATAACTTAAGGTAAAGGAGTGG + Intergenic
1087631038 11:100650439-100650461 GTAAACTTAAGGTAAAGGAGTGG + Intergenic
1087639655 11:100742929-100742951 ATAAATCCAAGGTAAAGGGATGG - Intronic
1087804517 11:102541135-102541157 ATAAACTTAAATTAAAGGGGTGG + Intergenic
1087866011 11:103228045-103228067 ATAAACTTAAGGTAAAGGGGTGG - Intronic
1088137511 11:106576153-106576175 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1088179661 11:107094577-107094599 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1088206631 11:107399351-107399373 ATAAACTTAAAATAAAGGGATGG + Intronic
1088271202 11:108036462-108036484 ATAAATTTAAAGTAAAGTGGGGG - Intronic
1088372264 11:109104744-109104766 AGAAACTTAAGGTAAAGGGGTGG - Intergenic
1088413315 11:109560979-109561001 ATAAACTCAAGGTAAAAGGATGG - Intergenic
1088413598 11:109565209-109565231 ATAAACTTAAGGTAAAATGGTGG - Intergenic
1088573095 11:111242053-111242075 ATACAATGAAGGTAAAGGTGTGG - Intergenic
1088580732 11:111313339-111313361 ATAAACTTAAGGAAAAGGGGCGG + Intergenic
1088800277 11:113299258-113299280 ATAAACTTTAGGTAAAGGGGTGG + Intergenic
1088951348 11:114573495-114573517 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1089107584 11:116025922-116025944 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1089826055 11:121278948-121278970 GTAAACTTAAAGTAAAGGGGTGG - Intergenic
1089837152 11:121380999-121381021 ATAAATTTAGGGTAAAGAGGTGG + Intergenic
1090303263 11:125666848-125666870 ATAAACTGAAAGTGAAGGGTTGG - Intronic
1090545444 11:127761341-127761363 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1090688427 11:129151006-129151028 CAAAACTTAAGGTAAAGGGGTGG + Intronic
1090756904 11:129800050-129800072 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1090894811 11:130962567-130962589 ATAAACTTACAATAAAGGGGTGG - Intergenic
1091380983 12:59198-59220 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1091966938 12:4752112-4752134 ATAAACTAAAAATAAAGGGATGG - Intronic
1092303697 12:7277910-7277932 ATAATCTTAAAGTAAAGGAGTGG - Intergenic
1092602863 12:10085425-10085447 ATAAACTTAAGGTAAAGAGGTGG + Intronic
1092700180 12:11219849-11219871 ATAAACTTAAGGTAAAGAGGTGG + Intergenic
1093001834 12:14005957-14005979 ATAAACTTAAGGTGAAGGGGTGG - Intergenic
1093010727 12:14103792-14103814 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1093103984 12:15063890-15063912 ATAAACTGAAAGTAAATGGATGG - Intergenic
1093105143 12:15077155-15077177 ACAGACTTGAAGTAAAGGGGTGG + Intergenic
1093135973 12:15451113-15451135 ATAAACTTAAGGTAAAGGGATGG + Intronic
1093266767 12:17013203-17013225 ATAGACTCAAGGTAAAGGAGTGG - Intergenic
1093277754 12:17150611-17150633 ATAAACTTAAGGTTTAGGGGTGG + Intergenic
1093468854 12:19479838-19479860 ATAAACTTAAGGTAAAGGGGTGG - Intronic
1093477428 12:19571619-19571641 ATAAGCTTAAAGTAAAAGGATGG - Intronic
1093488510 12:19679499-19679521 ATAAACTTAAAGTAAAGGGATGG - Intronic
1093598138 12:20986665-20986687 ATAAACTTAAAGCTAAGGGGTGG - Intergenic
1093720774 12:22439238-22439260 ATAAACTTAAAATAAAGGGGTGG + Intergenic
1093948567 12:25137671-25137693 ATAAACTTAAAGTAAAGAGGTGG + Intronic
1093995163 12:25632949-25632971 ATAAACTTAAAGTAAAAGGGTGG + Intronic
1094263251 12:28525955-28525977 ACAAACTTAAGGTAAAGGGATGG - Intronic
1094297386 12:28922985-28923007 ATAAACTTAAGATAAAGTGATGG + Intergenic
1094328188 12:29262927-29262949 ATAAACTGAAAATAAAGGGATGG + Intronic
1094447162 12:30544363-30544385 ATAAACTTAAAGTCAAGGGGTGG - Intergenic
1094501513 12:31025165-31025187 ATAAACTTAAAGTAAAGGCGTGG + Intergenic
1094721825 12:33073539-33073561 ATAAACTTCAGATAAAGTGGTGG - Intergenic
1094789414 12:33894327-33894349 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1095121038 12:38419402-38419424 ATAAACTTAAGCTAAAGTGGTGG + Intergenic
1095225998 12:39677222-39677244 ATAAACTTAAGGGGAAGAGGTGG + Intronic
1095500848 12:42837271-42837293 ATAAACTTAAGGTAAGGGGGTGG - Intergenic
1095557591 12:43525652-43525674 ATAAACTCAAGGTAAAGAGGTGG + Intronic
1095665372 12:44790793-44790815 ATAAACTTCAAGTAAAGGCATGG + Intronic
1095777014 12:46021285-46021307 ACAAACTCAAGGTAAAGGGGTGG - Intergenic
1095784680 12:46096436-46096458 ATAAACTCAAGGTAAAGGGATGG + Intergenic
1095786394 12:46113038-46113060 ATAGACTCAAGGTAAAGGGATGG + Intergenic
1095893013 12:47252218-47252240 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1096082024 12:48840001-48840023 AGAAGCCTAAGGTAAAGGAGAGG - Exonic
1096348086 12:50868275-50868297 ATAAACTTAAAGTAAAGGAGTGG + Intronic
1096437871 12:51610246-51610268 ATAAACTTCAGGTAAACAGGTGG - Intronic
1096897386 12:54837448-54837470 ATAGACTTGAGGTAAAGGGGTGG - Intronic
1096957035 12:55536635-55536657 AGAAACTTAAAGTAAAAGGGTGG + Intergenic
1097295701 12:57960043-57960065 ATAAACTTAAACTAAAGGGGTGG + Intergenic
1097303282 12:58041497-58041519 ATAAGCTCAAAGTAAATGGGTGG - Intergenic
1097385762 12:58948604-58948626 ATAACCTTAAAGTAAAGGTGGGG - Intergenic
1097547709 12:61024766-61024788 ATAAACTTAATGTAAAGGGGTGG - Intergenic
1097603828 12:61728589-61728611 ATAAACTTAAGGCAAAGGGGTGG - Intronic
1097659955 12:62418793-62418815 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1097760797 12:63461631-63461653 ATAAACTTAAAGTACAGGGGTGG + Intergenic
1097872725 12:64614490-64614512 ATTAACTTAATGAAAGGGGGAGG + Intronic
1097900363 12:64866893-64866915 ACAAATTAAAGGTAAAGAGGTGG + Exonic
1098502031 12:71204006-71204028 ATAGATTCAAGGTAAAGGAGAGG + Intronic
1098518819 12:71411486-71411508 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1098735275 12:74093954-74093976 ATAGACTGAAAGTGAAGGGGTGG - Intergenic
1098786259 12:74760239-74760261 ATAAACTTAAGGTAGAGGGGCGG - Intergenic
1098801712 12:74968169-74968191 ATAAGCTCAAAGTAAAGGGACGG + Intergenic
1098852439 12:75612886-75612908 ATAAACTTAAGGTAAATGGATGG + Intergenic
1098960670 12:76737014-76737036 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1098982480 12:76972413-76972435 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1099392221 12:82095988-82096010 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1099715221 12:86284543-86284565 ATAAACATAAGGGATAAGGGTGG - Intronic
1099744739 12:86688210-86688232 ATAAGCTCAAGATAAAGGGATGG - Intronic
1099759351 12:86896583-86896605 ATAGACTCAAGGTAAAGAGTTGG + Intergenic
1099777231 12:87149503-87149525 ATAAACTTAAAGTAATGAGGTGG - Intergenic
1099875187 12:88395230-88395252 ATAAACTCAAAATGAAGGGGTGG + Intergenic
1100187291 12:92151640-92151662 ATTAGTTTAAGGGAAAGGGGAGG - Intergenic
1100290799 12:93213109-93213131 AAAAACTTAAAATAAAGGGGTGG - Intergenic
1100420769 12:94430890-94430912 ATAGACTGAAAGTAAAGGGATGG + Intronic
1100697045 12:97106161-97106183 ACAAACTTAAGGTAAAGGGGTGG - Intergenic
1100706498 12:97205630-97205652 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1100920832 12:99484872-99484894 ATAAACTGAGGGCAAAAGGGTGG - Intronic
1100937165 12:99681896-99681918 ATAAACTTAAGGAAAAGGGGTGG + Intronic
1100970650 12:100066156-100066178 ACAAACTTAAGGTAAAGGGGTGG + Intronic
1101290589 12:103363624-103363646 ACAAACTTAAGGTAAAGGGGTGG + Intronic
1101298053 12:103446639-103446661 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1101635069 12:106533639-106533661 ATAAACTTAAAGTAAAGGAGTGG - Intronic
1102666266 12:114576083-114576105 ATAAAATTAAAATAAAAGGGAGG - Intergenic
1103179120 12:118892395-118892417 ATAGGCTTAAAGTAAAGGGATGG + Intergenic
1104524470 12:129505884-129505906 ATAAACTTAAGGTAGAGGGGTGG - Intronic
1104741660 12:131179994-131180016 ATAGACTCAAGGTAAAGGGGTGG + Intergenic
1104787900 12:131461549-131461571 ATTAACTGAAGAAAAAGGGGTGG + Intergenic
1105598677 13:21865328-21865350 ATAAACTTAAGGTAAAGTGGAGG - Intergenic
1105908480 13:24837004-24837026 ATAAACTTGAACTAAAGGGGTGG + Intronic
1105930957 13:25051332-25051354 ATACACTTGAACTAAAGGGGTGG + Intergenic
1106060165 13:26282844-26282866 ATAAACTTAAGGTAAAAGGGTGG + Intronic
1106325778 13:28687954-28687976 ATAAACTCAAGGTAAAGGTGTGG - Intergenic
1106392049 13:29344510-29344532 ATAAACTTAAGGTAGAGGGGTGG - Intronic
1106424749 13:29615835-29615857 ATAAACTTAAGGTAGAGGGATGG + Intergenic
1106572938 13:30945308-30945330 ATAAACCCAAGGAAAAAGGGTGG - Intronic
1106937957 13:34745429-34745451 ATAAACTTAAAGTAAACAGGTGG - Intergenic
1106977953 13:35245157-35245179 ATAAAATTAAGGTAAAAGGGTGG - Intronic
1107426616 13:40300207-40300229 GTAAACTTAAGGTAAAGGGGTGG - Intergenic
1107666087 13:42692546-42692568 ATAAACTTAAAGTAAAGAGGTGG - Intergenic
1108132085 13:47312350-47312372 ATAAACTTAAGGTAAAGAGGTGG + Intergenic
1108134543 13:47341052-47341074 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1108134747 13:47343530-47343552 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1108469583 13:50754534-50754556 ATAAACTTAAAGTAAAGGGGTGG - Intronic
1108817282 13:54307170-54307192 ATAAGCTTAAAGTAAAGGGCTGG + Intergenic
1108831843 13:54488857-54488879 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1108902269 13:55426108-55426130 ATAAACTTAAGGTAAAGAAATGG + Intergenic
1109001897 13:56815054-56815076 ATAAACTCAAGGTAAGTGGGTGG + Intergenic
1109047701 13:57435351-57435373 ATAAAGTTAAAGTAAAGGGGTGG - Intergenic
1109058129 13:57579213-57579235 ATAAACTTAAGGTAAGAGGGTGG - Intergenic
1109112516 13:58340003-58340025 ATAAACTGAAAATAAAGGGATGG - Intergenic
1109201156 13:59433040-59433062 ATAAACTTAAGGTAAAGAGGTGG - Intergenic
1109508182 13:63334753-63334775 ATAAATTTAAAGTAAAGGGGTGG - Intergenic
1109567378 13:64134929-64134951 ATAAACTTAAGGTAAAGAGGTGG - Intergenic
1109596895 13:64568392-64568414 ATAAACTTAATGTAAAGAGGTGG - Intergenic
1109618080 13:64863156-64863178 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1109625193 13:64964758-64964780 AGAAACTTAAGGTAAAGTGGTGG + Intergenic
1109822437 13:67675633-67675655 ATGAACTTAAGGTAAAGGGGTGG - Intergenic
1109824416 13:67698742-67698764 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1109975830 13:69830227-69830249 ATAAATTTAAGGTAAATGAGTGG + Intronic
1110182033 13:72628288-72628310 ATAAACTTAAGGTGAAGGGTTGG + Intergenic
1110301194 13:73929243-73929265 ATAAACTAAAGGAACAGAGGAGG + Intronic
1110340737 13:74387104-74387126 ATAAACTTAAGATAAAGGAGTGG - Intergenic
1110491502 13:76114519-76114541 ATAAACTTAGAGAAAAGGGATGG + Intergenic
1110504918 13:76274033-76274055 ATAAACCTAAGGTAAAGGGGTGG + Intergenic
1110627769 13:77670360-77670382 ATAAACTTAAAATAAAGGGGTGG + Intergenic
1110793464 13:79611105-79611127 ATAAACTTAAGATAAAGGGATGG - Intergenic
1110888014 13:80663115-80663137 ACAGACTCAAGATAAAGGGGTGG - Intergenic
1110889707 13:80683548-80683570 ATAAAGTAAAGATGAAGGGGTGG - Intergenic
1111080301 13:83297589-83297611 ATAAGCTCAAAGTAAAGGGGTGG - Intergenic
1111145067 13:84168656-84168678 ACAGACTTAAGGTAAAGGGGTGG - Intergenic
1111148672 13:84218687-84218709 ATAAAATTAAGATAAAGGGGTGG + Intergenic
1111156353 13:84332191-84332213 ATAATCTTAAGGGAAATGGATGG - Intergenic
1111164691 13:84444132-84444154 ACAGACTCAAGGTAAAGGAGTGG - Intergenic
1111283220 13:86053824-86053846 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1111722074 13:91958161-91958183 ATAGACTGAAAGTAAAGTGGGGG + Intronic
1111823365 13:93240500-93240522 ATAGACTCAAGGTAAAGGAGTGG - Intronic
1112035198 13:95491116-95491138 ATAAACTTAAAGTAAAGGGGTGG - Intronic
1112068694 13:95823619-95823641 ATAAATTCAAGGTAAAGGGATGG - Intronic
1112137673 13:96600529-96600551 ATAAACTCAAGGTCAAAAGGTGG - Intronic
1112738328 13:102445630-102445652 ACGAACTTAAAGTAAAGGGGTGG + Intergenic
1112747511 13:102543355-102543377 ATAAACTTAAAGTAAATGGGTGG + Intergenic
1112945513 13:104921928-104921950 AAAAACTTAAAGTAAAGGGGTGG + Intergenic
1113269749 13:108660636-108660658 ATAAACTTAAAGTAAAGGGGTGG - Intronic
1113534835 13:111057682-111057704 ATAAATGTAAGGTGAGGGGGTGG - Intergenic
1113845432 13:113386670-113386692 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1114274017 14:21125419-21125441 ATAAACTGAAAGTGAAGGGATGG + Intergenic
1114337141 14:21701763-21701785 ATAAGCTTAAGGTAAAGGGGTGG + Intergenic
1114691981 14:24592134-24592156 ATAAACTTAAAGTAAAAGGGTGG - Intergenic
1114698395 14:24649487-24649509 ATAGACTCAAGGCAAAGGGGTGG + Intergenic
1114756491 14:25266130-25266152 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1115299463 14:31867443-31867465 ACTCACTTAAAGTAAAGGGGTGG + Intergenic
1115329331 14:32178215-32178237 ACAGACTGAAGGTAAAGGGGTGG - Intergenic
1115350438 14:32389203-32389225 ACAAACTTAAGGTAAAGGGGTGG - Intronic
1115937918 14:38576052-38576074 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1115958885 14:38812028-38812050 ATAAACTTAAAGTAAAGGGTTGG + Intergenic
1115970045 14:38934671-38934693 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1115997245 14:39206832-39206854 ATAAACTTAGAGTAAAGGGATGG + Intergenic
1116048842 14:39779333-39779355 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1116117977 14:40681818-40681840 ACGAACTCAAGGTAAAAGGGTGG - Intergenic
1116324613 14:43516323-43516345 ATAAACATAAGGTAAAGGAGTGG + Intergenic
1116335703 14:43653410-43653432 ACAAACTTAGGGTAAAGGGGTGG + Intergenic
1116346955 14:43805770-43805792 ATAAAATGAAAGTAAAGCGGCGG + Intergenic
1116402031 14:44519402-44519424 ATAAACTGAAAGTGAAGTGGTGG - Intergenic
1116695203 14:48166479-48166501 ATAAACTCAAGGTAAAGAAGTGG + Intergenic
1116732192 14:48637960-48637982 ATAAGCTTAAAGCAAAAGGGTGG + Intergenic
1116782647 14:49252883-49252905 ATAGGCTCAAAGTAAAGGGGTGG + Intergenic
1116993434 14:51298997-51299019 AAAACCTCATGGTAAAGGGGAGG + Intergenic
1117103597 14:52376501-52376523 ATAAACTTAAGATAAAGGGGTGG - Intergenic
1117112965 14:52477452-52477474 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1117182405 14:53204470-53204492 ATAAACTTAAGGTAAAGGGTTGG + Intergenic
1117193240 14:53314575-53314597 ATAAACTTAAGGTAAAGCGGTGG - Intergenic
1117240913 14:53831477-53831499 ATAAACTCAAGGTAAAGGGGTGG + Intergenic
1117271560 14:54148851-54148873 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
1117509932 14:56440937-56440959 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1117640031 14:57788050-57788072 ATAGACTTAAAGCAAAGGGGTGG + Intronic
1117655225 14:57949390-57949412 ATAAACTTAAGGTAAAGGGGTGG - Intronic
1117822566 14:59665718-59665740 ATAAGCTTAAAATAAAGGGATGG + Intronic
1118050860 14:62026160-62026182 CTATACTTAAGGAAAAGGGCAGG - Intronic
1118149049 14:63168569-63168591 ATAAACTAAAAGTGAAGGGATGG + Intergenic
1118162500 14:63303969-63303991 ATAAACTTAAAGTAAAGGGGAGG + Intergenic
1118165784 14:63334413-63334435 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1118421033 14:65603884-65603906 ATAAACTTAAGGTACAGGGGTGG + Intronic
1119098668 14:71858229-71858251 ATAAACTTCAAGTAAAGGGGTGG + Intergenic
1119334721 14:73823303-73823325 ATAAACTAAAGATGAAGGGAAGG - Intergenic
1120400146 14:84021131-84021153 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1120450736 14:84664087-84664109 ATAAACTTAAGGTAAACGGGTGG - Intergenic
1120545569 14:85807505-85807527 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1120626558 14:86833851-86833873 ATAGACTGAAAGTAAAGGGCTGG + Intergenic
1120785469 14:88530565-88530587 ATAAACTTAAGGTAAAGGAGTGG + Intronic
1121058187 14:90878402-90878424 AGAAACTTAGGGAAAAGGGGCGG - Intronic
1121460066 14:94068140-94068162 ATAAACTTAAAGTAAAGGGGTGG + Intronic
1121503271 14:94456882-94456904 ATAAATGTAAGGTAAAGGGGTGG - Intergenic
1121848242 14:97194600-97194622 CTAAACTTAAGGTAAAGGGGTGG - Intergenic
1122432634 14:101665468-101665490 ATAAGCATAAGGAAAAGGGGTGG + Intergenic
1123143160 14:106102671-106102693 GTAAACTCAAGGTAAAATGGTGG - Intergenic
1123220052 14:106846769-106846791 ATAAACTCAAGGTAAAAGGTTGG - Intergenic
1123905485 15:24916319-24916341 AAAAACTTAGGGGAAAGTGGGGG + Intronic
1124505313 15:30267495-30267517 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1124557333 15:30738258-30738280 ATAAACTTAAAGTAAAAGGGTGG + Intronic
1124673930 15:31667489-31667511 GTAAACTTAAAGTAAAGGGGTGG - Intronic
1124738239 15:32271136-32271158 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1125145643 15:36464907-36464929 ATAAACTCAAGGTAAAGGGGTGG - Intergenic
1125274364 15:37975600-37975622 ATAGACTTAAAGTAAAGGGATGG - Intergenic
1125300162 15:38246310-38246332 ATTAACTAAGGGTAAAAGGGAGG - Intergenic
1125384054 15:39117437-39117459 ATAGGCTTAATGTAAAGGGTTGG + Intergenic
1126320954 15:47422612-47422634 ATGAACTTAATTGAAAGGGGAGG - Intronic
1126505925 15:49404626-49404648 ATAGTCTTAAAGTAAAGGGATGG - Intronic
1126521243 15:49596751-49596773 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1126566126 15:50101369-50101391 ATAAACTTAAGGTAATGGGGTGG + Intronic
1126572928 15:50170837-50170859 ATAAACTTACAGTAATGGGGTGG + Intronic
1126997237 15:54458759-54458781 ATAAACTTAAGGTAAAGGGATGG - Intronic
1127036302 15:54921983-54922005 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1127037540 15:54934828-54934850 ATAGACCTAAAATAAAGGGGTGG - Intergenic
1127194667 15:56570680-56570702 ATAAGCTTAAGGTACAAGGGTGG + Intergenic
1127694474 15:61431621-61431643 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1128380162 15:67106462-67106484 ATAGAGTTAAGATGAAGGGGAGG - Intronic
1129091374 15:73154710-73154732 ATAGACTGAAAGTAAAAGGGTGG - Intronic
1129631902 15:77269296-77269318 ATAAAGCTAAGGTAACAGGGTGG + Intronic
1129928884 15:79391944-79391966 ATAAACTTAAACTGAAAGGGTGG - Intronic
1130174825 15:81557552-81557574 ACAGACTCAAAGTAAAGGGGAGG - Intergenic
1130365885 15:83238396-83238418 ATAGACTGAAAGTAAAGGGATGG + Intergenic
1130398533 15:83527574-83527596 ATAAACTAAAAGTAAAGGGATGG - Intronic
1130749564 15:86696443-86696465 ATAGACTTAAGGTAAAAAGGTGG - Intronic
1131413968 15:92235463-92235485 AAACACTCAAGGTAAAGGGGTGG + Intergenic
1131828508 15:96339457-96339479 ACAGACTGAAGGTAAAGGGGGGG - Exonic
1132033592 15:98459757-98459779 ATAAACTTAAGATAAAGGGGTGG + Intronic
1132156863 15:99501914-99501936 GTAAATTGAAGGTGAAGGGGAGG - Intergenic
1132253912 15:100357390-100357412 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
1133141841 16:3750846-3750868 ATAAACTAAATGTAAAGGGCAGG + Intronic
1133782047 16:8946970-8946992 ACGAACTTAAGGTAATGGGGCGG + Intronic
1133944680 16:10338315-10338337 ATACACCTAAGGGAAAAGGGAGG + Intronic
1133952936 16:10413022-10413044 ATAAGCTTAAGGTAAAGGGGTGG - Intronic
1135203048 16:20455928-20455950 ATAAACTTAAGGTAAGGGGGTGG + Intronic
1135216051 16:20571933-20571955 ATAAACTTAAGGTAAGGGGGTGG - Intronic
1135901841 16:26467040-26467062 ATAAACTTAAAGCAAAGGGGTGG + Intergenic
1135942482 16:26834666-26834688 ATATATTAAAAGTAAAGGGGTGG + Intergenic
1136296020 16:29302437-29302459 ATAAACATAAGGAAAAAGGCAGG - Intergenic
1137397544 16:48126799-48126821 ATAAATTGAAGATAAAGTGGGGG - Intronic
1137418570 16:48310160-48310182 ACAGACTGAAGGTAAAGGGGTGG - Intronic
1137828792 16:51524467-51524489 ATAAAATTAATGTACAGTGGAGG + Intergenic
1138192315 16:55024087-55024109 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1140064083 16:71595133-71595155 ATAAACTTAAAGTAAAGGAGTGG + Intergenic
1140507777 16:75484865-75484887 AAAAACTCAAGGTAAAGATGAGG + Intronic
1140720519 16:77767430-77767452 ATGAACTTAAGGGAAAAGTGAGG - Intergenic
1141211652 16:81986439-81986461 ATAAACTTGAGGAGAAGGAGAGG + Intergenic
1142101939 16:88276624-88276646 ATAAACATAAGGAAAAAGGCAGG - Intergenic
1142840962 17:2629945-2629967 ATAAATTTAAAGTAAAGGGGTGG - Intronic
1142940127 17:3373655-3373677 GGAAACTTAAGGTAAAGGGGTGG - Intergenic
1143413957 17:6731830-6731852 ATAGACTGAAAATAAAGGGGTGG + Intergenic
1143991024 17:10961717-10961739 ATAAACTTAAAGTAAAGGGATGG + Intergenic
1144139466 17:12334735-12334757 ATAAACTTAAAGTGAAGGGGTGG - Intergenic
1144278167 17:13697373-13697395 ATAAACTTAAGATAAAGGGGTGG - Intergenic
1144616278 17:16776986-16777008 ATAAACTTAAGGCAAAGGGTTGG + Intronic
1144896425 17:18538673-18538695 ATAAACTTAAGGCAAAGGGTTGG - Intergenic
1145135792 17:20405544-20405566 ATAAACTTAAGGCAAAGGGTTGG + Intergenic
1145361740 17:22217601-22217623 ACAAACAAAAGGTAATGGGGGGG + Intergenic
1145962122 17:28892949-28892971 ATAAGTTAAAGGTAAAGGGTGGG - Intronic
1146583599 17:34061653-34061675 ATAAACTTAAAGTAAAGGGGTGG + Intronic
1146612924 17:34323981-34324003 ATGAGCTTAAGATAGAGGGGTGG - Intergenic
1146746454 17:35334497-35334519 AAAAACTTAAGGTAAAAAGATGG - Intergenic
1146839854 17:36143656-36143678 AGAAACTTCAGGCAAGGGGGTGG - Intergenic
1147617487 17:41838203-41838225 CTAAAGTTAAGGTGATGGGGTGG - Intronic
1147731178 17:42603557-42603579 AAAAACTAAAGGTAAAGAGAGGG + Intronic
1148400387 17:47354727-47354749 ATAAACCTAAGGTAAAGGGGTGG - Intronic
1148408049 17:47437621-47437643 ATAAACTTAAAGTAAAGGGGTGG - Intronic
1149221593 17:54420461-54420483 ATAAACTTAAGGTTAAGGGGTGG + Intergenic
1149410698 17:56403520-56403542 GTAAACTTACAGTAAAAGGGTGG - Intronic
1149906581 17:60532076-60532098 ATAAACTAAAAATAAAGGGTTGG + Intergenic
1150206740 17:63414751-63414773 ATAAAGATCAGCTAAAGGGGTGG + Intronic
1150896085 17:69212810-69212832 ATAAACTTAAGGTAAAGGGGTGG - Intronic
1150945281 17:69739369-69739391 ATAAACTTAAAGTAAAAGGGTGG - Intergenic
1151079012 17:71306720-71306742 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1152949652 17:83221534-83221556 AAAAACTTAATGGAAAGAGGAGG + Intergenic
1153079714 18:1208589-1208611 ATAAACTTAAGGTAAAGGCGTGG - Intergenic
1153207001 18:2714334-2714356 ATAGACTGAAGGTAAAGGTGTGG - Intronic
1153268923 18:3299187-3299209 ATAGATTCAAGGTAAAGGAGTGG + Intergenic
1153396200 18:4624050-4624072 GTAAACTCAAGGTAAAGGGGTGG - Intergenic
1153400670 18:4680898-4680920 ATCAACTTAAAGTAAAGGGATGG + Intergenic
1153425242 18:4955665-4955687 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1153451161 18:5231031-5231053 ATAAACTTAAGATAAAAGGATGG - Intergenic
1153532791 18:6066719-6066741 ATAAACTTAAGGTAAAGGGGTGG - Intronic
1153790260 18:8572503-8572525 ATAAAATTTAGGTAAAGGCTGGG - Intergenic
1153828961 18:8902956-8902978 ATATACTTAAGGTAAAGGGGTGG + Intergenic
1153869678 18:9305956-9305978 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1153951527 18:10061625-10061647 ATAAAAATAAAGAAAAGGGGAGG - Intergenic
1153965728 18:10180288-10180310 ATAAACTTTAAGTAAATGGGTGG - Intergenic
1154298077 18:13167816-13167838 AAAAATTTAAGGTAAAGGGATGG + Intergenic
1155286977 18:24299089-24299111 ATAAACTCAAGGTAAAGGGGTGG - Intronic
1155534134 18:26798174-26798196 ATAAACTTAAAATAAAAGGATGG + Intergenic
1155771609 18:29708077-29708099 ATAAACTCAAAGTAAAGGGGTGG - Intergenic
1155882489 18:31166940-31166962 ATAAACCTAAAGTCAAGTGGTGG + Intergenic
1156188959 18:34696590-34696612 ATAAAAATAAGGTAAAGGAATGG + Intronic
1156594711 18:38535157-38535179 ATAAACTTAATGCAAAGGTGTGG + Intergenic
1156642709 18:39121495-39121517 ATAAACTTCAGGTAAAGGGGTGG + Intergenic
1156667674 18:39427536-39427558 ATAAACTTAAGGTAAAGAAGTGG + Intergenic
1156962058 18:43044105-43044127 TTAAAGTCAAGGTAAAAGGGAGG + Intronic
1157218792 18:45809017-45809039 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1157507701 18:48240978-48241000 ATAGACTTAAGGTTAAGGGGTGG + Intronic
1157541048 18:48507267-48507289 ATAAACTTAAACTAAAGGGGTGG + Intergenic
1158577813 18:58654707-58654729 ATAGACTAAAAGTAAAGAGGTGG - Intergenic
1158656568 18:59341000-59341022 ATAGACTGAAAGTAAAGAGGTGG + Intronic
1158996874 18:62930359-62930381 ATAGACTCAAAGTAAAGGGAAGG + Intronic
1159398231 18:67893059-67893081 ACAAACTTCAGGTAGATGGGAGG + Intergenic
1159453844 18:68636769-68636791 ATACACTTAAGGTAAAGGGGTGG - Intergenic
1159612675 18:70544150-70544172 AAAAACTTAAGGTAAAGGGGTGG - Intergenic
1159705763 18:71684655-71684677 ATAGACTGAAAATAAAGGGGTGG + Intergenic
1159838642 18:73371254-73371276 ATAAACTAAAAGTAAAGGGGTGG + Intergenic
1159906795 18:74099694-74099716 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1160267418 18:77352108-77352130 ATAAACTTGAAGTAAAGGGGTGG - Intergenic
1160471867 18:79142928-79142950 ATAAACTGAATGTAAAAGGAAGG + Intronic
1163855657 19:19700106-19700128 TTAAACTTAAGGCAAAGGGTTGG - Intergenic
1163871663 19:19826318-19826340 TTAAACTTAAGGGAAAGGGTTGG + Intergenic
1163888064 19:19986285-19986307 ACTCACTTAAGGTAAAGGGTTGG + Intergenic
1163897256 19:20069970-20069992 ATAAACTTAAGGCAAAGGGTTGG + Intergenic
1163907974 19:20163703-20163725 ATAAAGTTAAGGTAAAGGGTTGG + Intergenic
1163935562 19:20439929-20439951 ATGAAGTTAAGGTAAAGGGTTGG - Intergenic
1163949908 19:20574361-20574383 ATAAACTTAAGGTAAAGGTTTGG - Intronic
1163968096 19:20767026-20767048 ATAAACTTAAGGTAAAGGATTGG + Intronic
1164267618 19:23634764-23634786 AAAAACTTAAGGTAAAGTGGTGG + Intronic
1164273601 19:23697080-23697102 ATAAACTTAAGGCAAAGAAATGG - Intergenic
1164319934 19:24135296-24135318 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1164497420 19:28779647-28779669 ATAAACTGAAAGTAAAAGGATGG + Intergenic
1164546478 19:29168962-29168984 CTACACTTAATGTAAAGGGTTGG + Intergenic
1164804060 19:31102606-31102628 ATATACTTAAGCTAGAGGAGGGG - Intergenic
1166262932 19:41654687-41654709 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1166604050 19:44124875-44124897 ATAAACTTAAAGTAAAAGGGTGG - Intronic
1166899877 19:46051764-46051786 ATAAACTTAAGGTAAATGGGTGG + Intronic
1167862331 19:52295689-52295711 ATAAAATAAAGATAAAGGGTTGG - Exonic
924992655 2:326889-326911 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
925322016 2:2978737-2978759 ATAGACTGAAAGTAAAGGGGTGG + Intergenic
925652086 2:6101975-6101997 ATACACTTAAGATAAAGGAGTGG - Intergenic
925795497 2:7537841-7537863 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
926181061 2:10643509-10643531 ATAAACTTAAAGGGAAGGGTGGG + Intronic
926560379 2:14410304-14410326 ATAAACTGAAAGTAAAGCGGTGG + Intergenic
926915798 2:17891269-17891291 AGAAACTTAAAGTAAAGGGGTGG - Intronic
927069752 2:19515319-19515341 ATTCACTTAAGGTAAAGGGGTGG - Intergenic
927176532 2:20413161-20413183 ATAAACTTAAGGTAAAGGAGTGG - Intergenic
927363296 2:22262963-22262985 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
927401201 2:22713047-22713069 ATAGACTCAAAGTAAAGTGGTGG - Intergenic
928019603 2:27692850-27692872 ATAGACTAAAGGTAAAGGAGTGG - Intronic
928356895 2:30624397-30624419 ATAAACTTAAGGTAAAGGGGTGG + Intronic
928443032 2:31309396-31309418 ATAAACTTAAGATAAAAGGATGG - Intergenic
928473155 2:31594330-31594352 ATAAACTTAAAGTAAAAGTGAGG + Intergenic
928479938 2:31673008-31673030 ATAAACTCAAGGTAAATGGGTGG - Intergenic
928499355 2:31873209-31873231 ATAAACTTAACCTAATGTGGAGG + Intronic
928685191 2:33742541-33742563 ATATACTTAAGGTAAAGGGGTGG - Intergenic
928782879 2:34846701-34846723 ATAAACTTAAGGTAAAGTAGTGG - Intergenic
928798668 2:35058469-35058491 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
928988667 2:37206931-37206953 ATAAACTTAAGGTAAAGGGGTGG + Intronic
929197297 2:39198116-39198138 ATAAGCTTAAAGTAAAGTGGGGG + Intronic
929307830 2:40384965-40384987 ATATACTTAAGGAGAAGTGGTGG - Intronic
929339308 2:40794085-40794107 TTTAACCTAAGGCAAAGGGGAGG - Intergenic
929398898 2:41556685-41556707 ATAAACTTAAGGTAAAAAGGTGG + Intergenic
930232021 2:48852844-48852866 ACAAACCTAAAATAAAGGGGAGG - Intergenic
930253445 2:49061332-49061354 ATAAACTGAAAGTGAAGGGATGG + Intronic
930404131 2:50932354-50932376 ATAAACTTAATGTAAAGAGGTGG - Intronic
930423273 2:51179848-51179870 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
930497685 2:52169212-52169234 ATAAAGATAAGGTAAATGTGTGG - Intergenic
930574111 2:53125457-53125479 ATAAACTTAAGGTAAAGGAGTGG - Intergenic
930682875 2:54276135-54276157 AAAAACTCAAGGTAAAGGATAGG - Intronic
930951548 2:57148834-57148856 ATAGACTTAAAATAAAGGGATGG + Intergenic
931136806 2:59412373-59412395 ACAAATTTAAGGTAAATGGGTGG - Intergenic
931536012 2:63277532-63277554 ATAAATTTAAGGTAAAGAGGTGG + Intronic
931548072 2:63410670-63410692 ATAAACTTCAAGTAAAGGGATGG + Intronic
931557553 2:63521334-63521356 ATAAGCTCAAAGTAAAGGGATGG + Intronic
931568773 2:63645863-63645885 ATAGACTGAATGTAAAGGGATGG - Intronic
931834826 2:66087554-66087576 ATAAATTTAAGGTAAATGGGTGG + Intergenic
932100361 2:68894127-68894149 CTAAACTTAAAGTAAAAGGGTGG - Intergenic
932634915 2:73379555-73379577 AGACATTTAAGGTAAAGTGGGGG + Intergenic
933086125 2:78056578-78056600 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
933110960 2:78399383-78399405 ATAAAATTAAGGTAAAGGGGTGG + Intergenic
933382210 2:81563244-81563266 ATAAAGTAAAGGTAAAGGGGTGG - Intergenic
933398115 2:81757091-81757113 ATACAATTAAGGTAAAGTGGTGG + Intergenic
933410925 2:81923942-81923964 ATAAACTTAAGACAAAGGGGTGG + Intergenic
933474555 2:82772770-82772792 GTAAATTTAAGGTAAAGAAGTGG + Intergenic
933627358 2:84616551-84616573 ATAAACTTAAGGTAAAGGGGTGG - Intronic
933642570 2:84779501-84779523 ATAGGCTCAAAGTAAAGGGGTGG - Intronic
934111159 2:88744855-88744877 ATAAACTTACTGTAAAGGGGTGG - Intronic
934731532 2:96661625-96661647 ATATAGTCAAGGTAATGGGGAGG - Intergenic
935000778 2:99012463-99012485 ATAAACTTAAGGTTAAAGGGTGG + Intronic
935007313 2:99091582-99091604 ATAAACTTAAGGTAAAGGGGTGG + Intronic
935439305 2:103073447-103073469 ATAAACTGAAAATAAAGGGATGG + Intergenic
935489156 2:103696111-103696133 ATAAACTCAAAATAAAGGGATGG - Intergenic
935519035 2:104081272-104081294 ATAAATTAAAAGTAAAGGGATGG - Intergenic
935913571 2:107924136-107924158 ATATACTTAAGATAAATGGGAGG + Intergenic
936141082 2:109941021-109941043 ATAAATTTAAGGTAAAGAGGTGG + Intergenic
936164650 2:110109330-110109352 ATAAACTTAAAGTAAAAGGGTGG + Intronic
936177770 2:110238966-110238988 ATAAATTTAAGGTAAAGAGGTGG + Intergenic
936203611 2:110430465-110430487 ATAAATTTAAGGTAAAGAGGTGG - Intronic
936555106 2:113489642-113489664 ATAAACTTAAGGTAAAGGGATGG + Intronic
936673974 2:114692942-114692964 ATAGACTTAAAATAAAGGGATGG - Intronic
936701848 2:115020288-115020310 ATAAACTTTAGGTAAAGTGGTGG + Intronic
936879206 2:117229986-117230008 ATAAACTCAAGGTGTAGGAGTGG - Intergenic
936884878 2:117298789-117298811 TTAAACTCAGGGTAAAGAGGTGG - Intergenic
936899111 2:117464289-117464311 ATGAACTTAAGGTAAAGGGGTGG - Intergenic
936899999 2:117472154-117472176 ATAAACTCAAGGTAAAGGGATGG - Intergenic
936910957 2:117593189-117593211 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
937058067 2:118956271-118956293 ATAAACTTAAAATAAAGGGGTGG + Intronic
937069047 2:119048495-119048517 GTAAACTTAAAGTGAAGGGGTGG - Intergenic
937173808 2:119905274-119905296 ATAGACTAAATGTAAAGGGAAGG + Intronic
937410767 2:121673029-121673051 ATAAACTTAATGTAAAGGAGTGG + Intergenic
937461318 2:122089877-122089899 ATAAACTTTAGGTAAAGGGGTGG - Intergenic
937572643 2:123382806-123382828 ATAAACTTAAGGTAAAGGAGTGG + Intergenic
937663213 2:124454179-124454201 ATAAACTTAAGGTAAAGGGATGG + Intronic
937716137 2:125035677-125035699 AAAAACTTAAGGTAAAGGGGCGG - Intergenic
937722867 2:125124421-125124443 ATAAACTTAAGGTAAAGGAGTGG - Intergenic
937781779 2:125847023-125847045 ATAAACTTAAAGTAAAGTGGTGG - Intergenic
937796478 2:126028434-126028456 ATTAACTTAAGGTAAAAGGCAGG - Intergenic
937798795 2:126057400-126057422 ATGAACTTAGGGTAAAGGGGTGG - Intergenic
937828767 2:126397540-126397562 ATAAACTTAAGGTAAAGTGGTGG - Intergenic
938037840 2:128051052-128051074 ATAAACTTAAAGTAAAGGGGAGG - Intergenic
938175563 2:129124141-129124163 ATAGACTCAAGGTAAAGGGGTGG - Intergenic
938564061 2:132501938-132501960 ATCAACTTAAGGTAAAGGTGTGG - Intronic
938674743 2:133620400-133620422 ATACACTTAAGGTAAAGGGATGG + Intergenic
939149694 2:138458297-138458319 ATAAACTTAAAGTAAAGTGGTGG + Intergenic
939240027 2:139546513-139546535 CTAAACTTAAGGTAAAGGAGTGG - Intergenic
939245574 2:139619409-139619431 ATAAACATCAGGTAAAGGGGTGG - Intergenic
939245845 2:139622639-139622661 AGAAAGTTAAGGGAAAGTGGAGG + Intergenic
939453602 2:142403426-142403448 ATAGACTGAAAGTAAAGGGATGG + Intergenic
939476805 2:142697173-142697195 ATAAATTTAAGGTGAAGGAGTGG + Intergenic
939769764 2:146300683-146300705 ATAAATTTAAAGTAAAGGGGTGG + Intergenic
940034506 2:149299908-149299930 ATAAAATTAAAGTAAAGGGGTGG - Intergenic
940131209 2:150385023-150385045 AAAGACTCAAGATAAAGGGGTGG - Intergenic
940217820 2:151318258-151318280 ATAAACTTAAGGTAAAGGAGTGG + Intergenic
940384688 2:153057347-153057369 GTAAACTTAAGGTAAAGGAGTGG - Intergenic
940387300 2:153088831-153088853 ATAAACATAAGGTAAAGGGGTGG - Intergenic
940423503 2:153506203-153506225 GTAAACCTAAGGTAAAGGTGTGG - Intergenic
940425641 2:153528207-153528229 ATAAACTGAAAGTAAATGGATGG + Intergenic
940430655 2:153586328-153586350 ATAGATTGAAAGTAAAGGGGTGG + Intergenic
940618484 2:156081974-156081996 ATAAACTTAAAGTAAAGTGGTGG - Intergenic
940630515 2:156231988-156232010 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
940706435 2:157110349-157110371 ATATACTCAAGGTAAAGAGGTGG + Intergenic
940709200 2:157142183-157142205 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
940734602 2:157436025-157436047 ATAAACTTAACGTAATGGAGAGG + Intronic
940796616 2:158087350-158087372 ATAAACTTAAGGTAAAGGGGTGG - Intronic
940802414 2:158147249-158147271 ACAAACTTCAGGTAAAGGGGTGG + Intergenic
941060863 2:160845027-160845049 ATAAACTTAAGGTAAAGGGATGG + Intergenic
941180742 2:162256186-162256208 ATAATCACAAGGTAGAGGGGTGG + Intergenic
941358175 2:164517644-164517666 ATAAACTTAAGGTAAAGGGGTGG + Intronic
941402013 2:165042873-165042895 ATAAACTTAAGGTAAATGAGTGG - Intergenic
941433643 2:165441335-165441357 TTAAACTTTTGGTAAAGGTGGGG - Intergenic
941467875 2:165852082-165852104 ATAGACTAAAAGTAAAGGGATGG - Intergenic
941679820 2:168385367-168385389 ATAAACTTAAGGTAAAGGAGTGG + Intergenic
941702308 2:168616514-168616536 ATAAACTTAAGGTAAAGGAGTGG + Intronic
941749864 2:169123206-169123228 ATAGACTGAAAGTAAAGGGATGG + Intergenic
942350530 2:175048155-175048177 ATAAACTAAAAGTGAAGGGATGG - Intergenic
942376307 2:175341320-175341342 ATAAACTGAAAGAAAGGGGGTGG - Intergenic
942405522 2:175649831-175649853 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
942579118 2:177397324-177397346 ATGCACTTAAGGAAAAAGGGAGG - Intronic
942743821 2:179209002-179209024 ATAAACTTAAGGTAAACAGGTGG + Intronic
942840638 2:180357177-180357199 TTAAACTCAAGGTAAAGAGGTGG - Intergenic
942846115 2:180428105-180428127 ATAAACTAAAAATAAAGGGAAGG + Intergenic
942863077 2:180638937-180638959 ATAGACTGAATATAAAGGGGTGG + Intergenic
943130536 2:183848285-183848307 ACAAACTTAAGGTAAAGACTTGG + Intergenic
943149734 2:184097282-184097304 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
943158887 2:184220584-184220606 ATAAACTCAAGGTGAAAGGGTGG - Intergenic
943199004 2:184794784-184794806 ATAAACTTAAGGTAAAGGGGTGG + Intronic
943446976 2:187998332-187998354 ATAGACTCAAGGTAAAGGGATGG + Intergenic
943449180 2:188026875-188026897 ATAAACTTAAGATAAAGGGGTGG - Intergenic
943607663 2:189995476-189995498 GTAAACTTAAGGTAAAAGGGTGG - Intronic
943654487 2:190493160-190493182 ATAAATTTAAGGTAAAGGGGTGG + Intronic
943879087 2:193115596-193115618 ATAAACTTAAAGTAAACAGAAGG + Intergenic
943891091 2:193288403-193288425 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
943909492 2:193544522-193544544 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
943943702 2:194031104-194031126 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
943989334 2:194667110-194667132 ATAAAGTTAAAGTAATTGGGGGG - Intergenic
944036365 2:195299028-195299050 ATCAAATGAAGGTAGAGGGGAGG - Intergenic
944063775 2:195597817-195597839 TTAAACTTAAGGTAAACAGAAGG - Intronic
944431836 2:199642538-199642560 ACAAACTTAAGGTAAAGTGGTGG - Intergenic
944485591 2:200201828-200201850 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
944528685 2:200646926-200646948 ATAAACTTAAAGTAAAGAAGTGG - Intronic
944603187 2:201324137-201324159 ATAAACTCAAGGGAAAAGGGTGG + Intronic
945131871 2:206582402-206582424 ATAAACTTAAAGTAAAGGGGTGG - Intronic
945209994 2:207372729-207372751 ATAGACTGAAAGAAAAGGGGTGG + Intergenic
945285891 2:208081075-208081097 ATAAACTTACGGTAAAGGGGTGG + Intergenic
945377185 2:209092787-209092809 GTAAACTTAAGGTAAAGGAGAGG - Intergenic
945389722 2:209249366-209249388 ATAAACTGAAAGTGAAGGGATGG + Intergenic
945480462 2:210339089-210339111 ATAAACTGAAAGTAAAGGGATGG - Intergenic
945482344 2:210358695-210358717 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
945521257 2:210830734-210830756 ATAAAATCAAGGTAAAGGGATGG - Intergenic
945536359 2:211023226-211023248 AAAAACTTAAGGTAAAGGGGTGG - Intergenic
945739070 2:213639102-213639124 ATAAACTTAAGGTGAAAAGATGG - Intronic
945824362 2:214701941-214701963 ATAAACTAAAAGTAAAGGGATGG + Intergenic
945861467 2:215127655-215127677 ACAAACTTAAAGTAAAGGGGTGG - Intronic
946501494 2:220252020-220252042 ATAAACTGAAAGTAAAGGGGTGG + Intergenic
946874744 2:224116223-224116245 ATAGACTCAAGGTCAAGGGGGGG + Intergenic
947281275 2:228458424-228458446 ATAGACTCAATGTAAAGGGTTGG - Intergenic
947456864 2:230263321-230263343 ATAAACTTAAAGTAAAGGGGTGG - Intronic
948531391 2:238608537-238608559 ATAAACTTAAGGTAAACTGGTGG + Intergenic
948576926 2:238958428-238958450 AAAAACTTAAGGTAAAGGGGTGG + Intergenic
1168941443 20:1714942-1714964 ATAAACTCAAGGTAACATGGTGG + Intergenic
1169335939 20:4757347-4757369 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1169401526 20:5284794-5284816 ATAAACTTAAAGGAAAGGGATGG + Intergenic
1169517240 20:6331216-6331238 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1170086429 20:12537431-12537453 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1170124994 20:12952984-12953006 ATTAACTTAAGGTAAAGGGGTGG - Intergenic
1170133735 20:13051221-13051243 ATAAACTTAAAGTAAACGGGTGG + Intronic
1170241520 20:14172198-14172220 ATAAACTTAAGGTAAAAGGGTGG - Intronic
1170251177 20:14284746-14284768 ATAAAATCAAAGTAAATGGGGGG - Intronic
1170375674 20:15697917-15697939 ATAAACTTAAAGTAAAGGGGTGG - Intronic
1170489278 20:16855604-16855626 ATAAACTTAAGGTAAAGGAGTGG - Intergenic
1170663907 20:18368887-18368909 ATAAACTGAAGGTAAAGAGATGG - Intergenic
1170726721 20:18935319-18935341 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1170741246 20:19058709-19058731 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
1170862946 20:20126075-20126097 ATAAACCTAAAGTAAAGGGGTGG - Intronic
1171027984 20:21649802-21649824 ACAAACTTAAGGTAAAGGGGTGG + Intergenic
1171038494 20:21737786-21737808 ATAAACTTAAGGTAAAGGAATGG - Intergenic
1171080377 20:22176246-22176268 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1171081402 20:22189128-22189150 ATAAACTTAAAGTAAGGGTGTGG - Intergenic
1171165807 20:22969350-22969372 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1171242096 20:23579444-23579466 ACAAACTTAAGGTAAAGGGGTGG - Intergenic
1171378453 20:24713014-24713036 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1171515144 20:25725181-25725203 ATAAACTAAAAATAAAGAGGTGG - Intergenic
1172851232 20:37967291-37967313 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1173568550 20:44060034-44060056 ATAACCTTTAGGTAAAGGGGTGG + Intronic
1175232919 20:57485938-57485960 TAGAACTTAAGGTAGAGGGGTGG - Intergenic
1175617871 20:60418164-60418186 ACAGCCTCAAGGTAAAGGGGTGG - Intergenic
1176653739 21:9571897-9571919 ATAAAATAAAGGAAAAGTGGAGG - Intergenic
1176694314 21:9956575-9956597 ATAGATTCAAGGTAAGGGGGTGG - Intergenic
1176865419 21:14049400-14049422 ATACATTAAAAGTAAAGGGGTGG + Intergenic
1176906285 21:14505376-14505398 ACAAACTTAAGGTACAGGGGTGG + Intronic
1177069417 21:16484829-16484851 ATAAACTTTAGGTAGAGGGGTGG - Intergenic
1177140772 21:17355413-17355435 ATAAACTTAAGATAAAGGGATGG + Intergenic
1177212213 21:18085145-18085167 ATAAACTAAAAGTAAAGGGGTGG - Intronic
1177294576 21:19158390-19158412 ATAGGCTCAAAGTAAAGGGGTGG - Intergenic
1177330897 21:19660759-19660781 ATAAACTTAAGGTAAAGAAGTGG + Intergenic
1177364354 21:20115263-20115285 ATAAACTTAAGATACACAGGTGG - Intergenic
1177430044 21:20980835-20980857 ATAGACTAAAAGTAAAGGGATGG - Intergenic
1177681198 21:24373745-24373767 ATAAACTTAAGGTAAATGAGTGG - Intergenic
1177749861 21:25267340-25267362 ATAAACTTAAGGTAAAGGTGGGG + Intergenic
1177847520 21:26307831-26307853 ATAAACTGAAAGTAAAGGGGTGG + Intergenic
1178659754 21:34497023-34497045 ATAAACTTAAGGTAAAGGAATGG - Intergenic
1178733062 21:35122586-35122608 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1178801877 21:35803197-35803219 ATAAACTTAAAGTAAAGGGGTGG + Intronic
1179083957 21:38200634-38200656 ATAAACTTAAGTTAAAGGGGTGG - Intronic
1179260470 21:39753843-39753865 ATAAACTCAAGGTGAAAGGTTGG - Intronic
1179268668 21:39830240-39830262 ATAAACTTAAGATAAAGAAGTGG - Intergenic
1179443511 21:41413326-41413348 CAAAACTTAAGGTAAAGGGGTGG + Intergenic
1179467571 21:41587285-41587307 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1179521014 21:41944563-41944585 GAAAACTTAAGGTCAAGGGATGG + Intronic
1180040075 21:45272188-45272210 ACAAACTTAAGGTAAAGGGGTGG + Intronic
1180250893 21:46587287-46587309 AGAAACTTAAGGTACACAGGTGG + Intergenic
1181454476 22:23048911-23048933 ATAAACTTAAGATAAAGGGGTGG + Intergenic
1182682821 22:32095713-32095735 ATAAATTTAAGGTAAAAGGGTGG - Intronic
1183048159 22:35238590-35238612 GTAAACTTAAAGTAAAGGGGTGG - Intergenic
1183153655 22:36057275-36057297 GTATACTGAAGGGAAAGGGGAGG + Intergenic
949145848 3:699227-699249 ATAAACTTAAGGTCAAGGGATGG - Intergenic
949189829 3:1238218-1238240 ATTTACTTATAGTAAAGGGGTGG + Intronic
950292819 3:11800443-11800465 ATAGACTGAAAGTAAAGGGGTGG + Intronic
950326940 3:12119840-12119862 AAAAACTCAAGGTGAAGGGAAGG - Intronic
950592198 3:13946022-13946044 ATAAACTTAAAGTACAAGCGTGG - Intronic
950599017 3:14015285-14015307 ATAAACTTAAGGTAAAGGGGTGG - Intronic
951130114 3:19032336-19032358 ATAAAGTGAAAATAAAGGGGTGG + Intergenic
951153539 3:19322049-19322071 GTAAACTTAGGGTAAAGGGGTGG - Intronic
951198365 3:19849543-19849565 ATAAACGTAAGAGAAAGGGGAGG + Intergenic
951259676 3:20492884-20492906 ATAAACTGAAAGTAAATGGATGG - Intergenic
951268267 3:20595808-20595830 ATAAACTTAAGGTAAAGGAGTGG - Intergenic
951294686 3:20919440-20919462 ATGAACTTAAGGTAAATGGATGG + Intergenic
951302495 3:21015759-21015781 ATAAACTTTAGGTAAAGGGGTGG - Intergenic
951326166 3:21304090-21304112 ATAAACTTAAGCTAAAGGGGTGG + Intergenic
951404818 3:22282964-22282986 ATAAACTTAAGGTAAAGGGGTGG + Intronic
951690821 3:25394761-25394783 ATAAACTTAAGGTAAAGGGGTGG - Intronic
951761246 3:26149056-26149078 CTCCACTTAAAGTAAAGGGGTGG + Intergenic
951764044 3:26177331-26177353 ATAAACTTAAGGTAAAGGAATGG - Intergenic
951849923 3:27127899-27127921 ATAAATTTCAGGAAGAGGGGAGG - Intronic
951852109 3:27152791-27152813 AAAAGTTTAAAGTAAAGGGGTGG + Intronic
952083073 3:29783825-29783847 ATAAACTTAAGGTAAAGGGATGG + Intronic
952183043 3:30939632-30939654 ATAAACTTAAGGTAAAGAGGTGG - Intergenic
952601702 3:35090860-35090882 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
952669700 3:35951776-35951798 ATAAGCTCAAAGTAAAGGGATGG - Intergenic
952689654 3:36190315-36190337 ACAAACTTAAGGTTAAGGGGTGG - Intergenic
952714724 3:36468950-36468972 ATAAACTTAAGGTAAAGGGGTGG - Intronic
952732685 3:36655251-36655273 ATAAATTTAAGGTAAAGGGGTGG + Intergenic
952941664 3:38449933-38449955 ATTAAGTTAAGAGAAAGGGGCGG + Intergenic
952984648 3:38768100-38768122 ATAAACTTAAGGTAAAGAGATGG - Intronic
953185476 3:40633606-40633628 ATAAACTTAAGGTAAAGGAGTGG + Intergenic
953195581 3:40729897-40729919 ATAAACTTAAGGTAAAGAAGTGG - Intergenic
953495343 3:43381346-43381368 ATAAACTTAAGGTAAAGGGGTGG + Intronic
953639344 3:44691226-44691248 ATAAACTTAAGGTAAAGGGATGG + Intergenic
953723694 3:45379405-45379427 ATAAACTTAAAATAAAGGGATGG - Intergenic
953806206 3:46070630-46070652 ATATACTGAAAGTAAAGGGGTGG - Intergenic
953822244 3:46217088-46217110 ATAAACTTAAGGTAAAGTGAGGG + Intronic
954479997 3:50790166-50790188 ATAAACTTAAGGTAAAAAGGTGG - Intronic
954496533 3:50969337-50969359 ATAGACTCAATGTAAAGGGGTGG - Intronic
955446009 3:59010337-59010359 ATAAACTTTGGGTAAAGGTGTGG + Intronic
955450556 3:59062705-59062727 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
955461420 3:59187837-59187859 ATAAACATAAAGTAAAGGGGTGG - Intergenic
955477343 3:59351652-59351674 GTAAACTTAAAGTAAAGGGGTGG - Intergenic
956303747 3:67801918-67801940 ATAGACTGAAGGCAAAGGAGTGG - Intergenic
956343729 3:68254642-68254664 ATAAAGGTAAGGTAAAGGAAGGG + Intronic
956362576 3:68464745-68464767 ATAAACTGAAGGTAGGAGGGTGG + Intronic
956950464 3:74275922-74275944 GAAAACTTAAAGTAAAGGGCTGG + Intronic
957016196 3:75067659-75067681 ATAAACTTAAAGTACAGGGGTGG - Intergenic
957678112 3:83396252-83396274 ATAAACTCAAAATAAAGGGGTGG + Intergenic
957681556 3:83442046-83442068 ACAAATTTAAGGTAAAGGCATGG + Intergenic
957971894 3:87392541-87392563 ATAAACTTAAGGTAAAGGGATGG + Intergenic
957981053 3:87511066-87511088 CTAAAATTAAAGTAAAGTGGAGG + Intergenic
958014021 3:87916509-87916531 ATAATCTTAAAGTAAAGGGGTGG + Intergenic
958066461 3:88550135-88550157 ATACACTTAACATAAAGAGGTGG - Intergenic
958100923 3:89009049-89009071 ATAGACTTAAAATAAAGGGATGG - Intergenic
958152332 3:89705976-89705998 ATAAACTTAAGGTAAAGAATTGG + Intergenic
958480595 3:94641585-94641607 ATAAACTAAAAGTAAAGTGATGG - Intergenic
958505809 3:94975417-94975439 ATAAACTTAAAGTAAAGGGATGG + Intergenic
958509915 3:95035076-95035098 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
958768536 3:98399160-98399182 ATAAACTCAAGGTAAAGGGGTGG + Intergenic
958770861 3:98423784-98423806 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
958775439 3:98477575-98477597 ATAAACTTAAGGTAAAGGAGTGG - Intergenic
958787170 3:98610886-98610908 ATAAACTTAAGGTAAAGGGATGG - Intergenic
958790007 3:98641567-98641589 ATAAACTTAAGGTAAAGGGATGG - Intergenic
958817761 3:98934925-98934947 ATAGACTCAAAGTAAAGGGATGG + Intergenic
958827090 3:99043220-99043242 ATAGACTGAAAGTAAAGGGATGG + Intergenic
958969731 3:100598847-100598869 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
959009546 3:101059422-101059444 ATAAACTTAAAGTAAAGGAGTGG - Intergenic
959047166 3:101486896-101486918 ATAAACTTAAGGTAAAGGGGTGG + Intronic
959125713 3:102288534-102288556 ATAGACTTAAGGTAAAGTTGTGG - Intronic
959354376 3:105306989-105307011 ATAGACTAAAAGTAAAGGGATGG + Intergenic
959361982 3:105404868-105404890 ATAAACTTATGATAAAGGTGTGG + Intronic
959424015 3:106163535-106163557 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
959436371 3:106319465-106319487 ATAAACTTAAGATAAAGGGATGG + Intergenic
959439214 3:106356524-106356546 ATAGGCTTAAAGTAAAGGGATGG - Intergenic
959459077 3:106602121-106602143 ATAAACTTAAAGTGAAGGAATGG - Intergenic
959464089 3:106664631-106664653 ATAGACTGAAGGTGAAGGGATGG + Intergenic
959630586 3:108502931-108502953 ATAGAATTAGGGAAAAGGGGAGG - Intronic
959666333 3:108926287-108926309 ATAAACTTAAGGTAAGGGGGTGG - Intronic
959715538 3:109429331-109429353 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
959722103 3:109503710-109503732 ACAAATTTAAAGTAAAGGGATGG - Intergenic
959727176 3:109557686-109557708 ATAAACTCAAGGTAAAGGGTTGG - Intergenic
959757283 3:109913859-109913881 ATAAACTTAAGATAAAAGAGTGG - Intergenic
959867686 3:111290171-111290193 ATAAACTTATGGTAAAGGTGTGG - Intergenic
959875347 3:111375475-111375497 ATAAACTTAAGGTAAAGAGGTGG + Intronic
959899259 3:111641276-111641298 ATAAACTTAAAGTAAAGGGGTGG + Intronic
960118695 3:113925138-113925160 ATAGGCTCAATGTAAAGGGGTGG - Intronic
960152875 3:114268993-114269015 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
960512657 3:118569854-118569876 ATAAACTTAAAGTAAAGTGGTGG - Intergenic
960516733 3:118610096-118610118 ATAAACTTAAGGTAAGGGGGTGG + Intergenic
960712143 3:120542153-120542175 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
960756657 3:121021048-121021070 ATAAACTTAAGATAAAGGGGTGG + Intronic
960761833 3:121080185-121080207 ATAAACTTAAGGTAAAGAGCTGG - Intronic
960769904 3:121181834-121181856 ATAAACTTCAGGTAAAGGGGTGG + Intronic
960782704 3:121337328-121337350 ACAAACTCGAGGTAAAGGGGTGG + Intronic
960976187 3:123176873-123176895 ATAAACATAAAGTAAAATGGGGG + Intronic
961407372 3:126690521-126690543 ATAAGTTTAAGGTAAAGGGGTGG + Intergenic
961850680 3:129814680-129814702 ATAGACTGAAAGTGAAGGGGTGG + Intronic
961977898 3:131045968-131045990 GTAAACTTAAGGTAAAGGGGTGG - Intronic
962013108 3:131412649-131412671 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
962034638 3:131638320-131638342 ATAAACTTAAGGTAAAGGGGTGG + Intronic
962065809 3:131979543-131979565 ATAAGTTTAAAGTAAAGGGGTGG - Intronic
962147231 3:132853410-132853432 ATCAACTTAAGGTAAAGGGATGG - Intergenic
962192080 3:133321295-133321317 AGAAACTTAAGGTAAAGTGGTGG + Intronic
962193836 3:133339243-133339265 ATAAACTGAAAATAAAGGGATGG + Intronic
962497687 3:135958843-135958865 ACAAACTGAAAGTGAAGGGGTGG - Intergenic
962503173 3:136016674-136016696 AGAGACTTAAGGTAAAGGGGTGG - Intronic
962504749 3:136035076-136035098 ACAAACTTAAGGTAAAGGAGTGG - Intronic
962530276 3:136273989-136274011 ATAACCTCAAGGTAAAGGGGGGG - Intronic
962651753 3:137501353-137501375 ATAATCTCAAGGTAAAGGGATGG - Intergenic
962673541 3:137734270-137734292 ACAAACTTAAGATAAAAGGTTGG - Intergenic
962709624 3:138074931-138074953 ACAAACTTAAGGTAAAGGGGCGG + Intronic
962861978 3:139412578-139412600 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
962870686 3:139489421-139489443 ATAGACTTAAAATAAAGGGATGG - Intergenic
962899692 3:139749523-139749545 ATAAATTGAAGGTAAAGGGTTGG - Intergenic
962983811 3:140516194-140516216 CATAACTTAAGGTAAAGGGGTGG - Intronic
962999583 3:140665994-140666016 ATAAACTTAAGGTAAAGGAGTGG + Intergenic
963014359 3:140807605-140807627 CTTAACTTAAGATAAAGGGGTGG - Intergenic
963176286 3:142300818-142300840 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
963213411 3:142719008-142719030 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
963373680 3:144436264-144436286 GTAAACTTAAGGTAAAGGGGTGG - Intergenic
963623156 3:147637154-147637176 ATAAACTTAAGGTAAAGGAGTGG + Intergenic
963824347 3:149935237-149935259 ATAGACTGAAAGTAAAGGGGTGG - Intronic
963832664 3:150024842-150024864 ATAAACTTAAGGTAAAGGGGTGG + Intronic
964017677 3:151966872-151966894 ATAAACTTAAGGTAGAGTGGGGG + Intergenic
964252947 3:154741162-154741184 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
964457483 3:156884133-156884155 ATAAATTTAAGGCAAAGGGGTGG - Intronic
964644040 3:158938753-158938775 ATAAACTTAAGGTAAAGGGATGG + Intergenic
964772832 3:160242142-160242164 ATAAACTTAAGGTAAAGGGGTGG + Intronic
964867676 3:161278882-161278904 ATAAACTTAAGGTAAAGAGGTGG + Intergenic
964913005 3:161804668-161804690 ATTAACTTAAGGAAAAGTGAGGG + Intergenic
964916146 3:161844599-161844621 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
964919363 3:161877195-161877217 ATAGACTCAAAGTAAAGGGTTGG + Intergenic
964967619 3:162516547-162516569 ATAAACTTAGTATAAAGAGGGGG + Intergenic
965026904 3:163313745-163313767 ATAAACTTAAGGTAAAAAGGTGG + Intergenic
965101742 3:164307537-164307559 ATAAGATTAAGGTAAAGTGGTGG + Intergenic
965345348 3:167541829-167541851 ATAAACTTAAGGTAAAGGGGTGG + Intronic
965573388 3:170193376-170193398 ATAAACTCAAGGTAAAGGAGTGG + Intergenic
965745620 3:171922059-171922081 ATAAACTTAAGGTAAAGGGGTGG + Intronic
965867251 3:173219467-173219489 ATAGACTGAAAGTAAAGAGGTGG - Intergenic
965874187 3:173297633-173297655 ACAAACTTAAGGTAAAGGGGTGG - Intergenic
966092931 3:176161681-176161703 ATAAAGTTAAGGTAAAGGGATGG + Intergenic
966122603 3:176538838-176538860 ATAAACTCAAGTTAAAGGGGTGG + Intergenic
966151446 3:176871640-176871662 ATAGACTAAAAGTAAAGGGATGG + Intergenic
966499562 3:180624275-180624297 ATATACTGAAAGTAAAGGGGTGG - Intronic
966519536 3:180857912-180857934 ACAGACTCAAAGTAAAGGGGTGG + Intronic
966553085 3:181227758-181227780 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
966758956 3:183398185-183398207 AATAACTGAAGGTAAAGGGGTGG - Intronic
967203511 3:187097127-187097149 GTAAACTCAGGGTAAAGGAGTGG + Intergenic
967209285 3:187152425-187152447 ATAAACTTAAAGTAAAGGGGTGG + Intronic
967236303 3:187386937-187386959 ATAAGCGTAAGGTAAAGGAGTGG + Intergenic
967257314 3:187607172-187607194 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
967504777 3:190241257-190241279 ATAAGCATAAGGTAAAGAAGTGG + Intergenic
967508679 3:190284629-190284651 ACAGACTGAAGGTAAAGGGATGG - Intergenic
967622007 3:191644520-191644542 ATAGGCTCAAGGTAAAGGGATGG + Intergenic
967651595 3:191992434-191992456 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
967696701 3:192540997-192541019 ATAAACTGAAAATAAAGGGATGG - Intronic
967741381 3:193006599-193006621 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
968125451 3:196156264-196156286 ACAAGCTTAAGGTAAAGGGCTGG - Intergenic
968807274 4:2782814-2782836 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
969165459 4:5306501-5306523 ATAAACTTAAGGTAAAGGGGTGG - Intronic
969947123 4:10795214-10795236 ATAAACTTAAAGTAAAGGGTTGG - Intergenic
970215627 4:13757012-13757034 ATAAACTGCAGGTAAAAGGGTGG - Intergenic
970217319 4:13773404-13773426 ATAAACTTAACGTAAAGGGGTGG - Intergenic
970312262 4:14794943-14794965 ATAAACCTAAGGTAAAAGAGTGG + Intergenic
970549103 4:17161778-17161800 ATAAACCTAAGGTAAAGGGGTGG - Intergenic
970658429 4:18258390-18258412 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
970856425 4:20653706-20653728 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
970996293 4:22270775-22270797 ATAAATTTAAAGTAAAAGGGTGG + Intergenic
971012791 4:22457277-22457299 ATAAACTAAAGGCAAAGGCATGG + Intronic
971050216 4:22853667-22853689 ATAAACTTAAGGTAGAGGGGTGG - Intergenic
971182915 4:24347617-24347639 ATACACTTAAAGTAAAGGGGTGG - Intergenic
971554773 4:28000299-28000321 ATATACTTAAGGTAAATTGGTGG - Intergenic
971841959 4:31864198-31864220 ATAAACTCAAAGGAAAGGGATGG + Intergenic
971900857 4:32656659-32656681 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
972018523 4:34278622-34278644 ATAGACTCAAGGTGAAGGGGTGG - Intergenic
972097145 4:35362597-35362619 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
972188868 4:36566787-36566809 ATAAACTTAAAAGAAAGGGGTGG - Intergenic
972806656 4:42535245-42535267 TAAAACTTAAGGTAAAAGGGTGG + Intronic
972826982 4:42769888-42769910 ATAAACTTAAGGCAAAGGAATGG + Intergenic
972956010 4:44392205-44392227 ATCAACTTAAAGGAAAGGAGAGG - Intronic
973091615 4:46144645-46144667 ATAAACTCAAGGTAAATAAGTGG - Intergenic
973179377 4:47249789-47249811 ATAAACTTAAAGTAAAAGGGTGG - Intronic
973244321 4:47994531-47994553 ATAAACTTAAGATAAAGGGGTGG - Intronic
973342867 4:49024205-49024227 CTAAACTTAAGGTAAAGGGGTGG - Intronic
973675853 4:53262113-53262135 ATAAACTTAAGGTAAAGGGGTGG - Intronic
973831310 4:54762680-54762702 ACAAACTTAAGGTAAAGGGGTGG - Intergenic
974182940 4:58406409-58406431 ATACACTTAATGTAAATGAGGGG + Intergenic
974848990 4:67382962-67382984 ATAAGCTTAAAGTAAAGGTGTGG + Intergenic
974986147 4:69028037-69028059 ATAAACTTAAGTTTAAGAGTAGG - Intronic
975061894 4:70013722-70013744 AAAAACATAAGATAAAGGGGTGG - Intergenic
975517494 4:75262454-75262476 ATAAACTTAAAGTAAAGAGGTGG + Intergenic
975623427 4:76317260-76317282 ATAAACTTAAGGTAAAGGGATGG + Intronic
975790329 4:77942736-77942758 ATCAACTTAAGGTAAAGAGGTGG - Intronic
975928587 4:79490963-79490985 ATAAATGTAAGGTAAATGGATGG - Intergenic
975943011 4:79670233-79670255 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
975944835 4:79693855-79693877 ATAAACTTAAGGTAAAGGGTTGG - Intergenic
975951213 4:79773619-79773641 ATAAACTTAAGGAAAAGGAGTGG + Intergenic
976020978 4:80625667-80625689 ATAGACTTAAAGTGAAGGGCTGG + Intronic
976460973 4:85312427-85312449 ATGAACTCAAGATAAAGGGGTGG - Intergenic
976556395 4:86455434-86455456 ATAAATTTAAGGTAAAGGGAAGG + Intronic
976562587 4:86519482-86519504 ATAAACTTAAGGTAAAGGGGTGG - Intronic
976686131 4:87817592-87817614 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
976762506 4:88565586-88565608 ATAAACTGAAAATAAAGGGGTGG - Intronic
976791454 4:88882794-88882816 ATAAACTTAATGTAAAGGGTTGG + Intronic
976856677 4:89612056-89612078 ATAAACTTAAAGTCAGGGGATGG + Intergenic
976869764 4:89776756-89776778 ATAAACTTAAGGTAAAGGGGTGG + Intronic
976888053 4:90009661-90009683 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
976918333 4:90406141-90406163 ATGAACTTAAGATAAAGGGGTGG + Intronic
976962911 4:91001616-91001638 ATAAATTTAAGGTAAAGGGGTGG - Intronic
977199313 4:94097108-94097130 ATAGACTGAAAGTAAAGGGATGG - Intergenic
977203414 4:94143110-94143132 ATAGACTGAAGGTAATGGGATGG + Intergenic
977263669 4:94829134-94829156 ATAAACTTAAGGTACAGTCAGGG - Intronic
977509830 4:97949279-97949301 ATAAACTCAAGGTAAAAGGGTGG - Intronic
977510703 4:97958521-97958543 ATAAACTTAAGGTAAAGGGGTGG + Intronic
977549517 4:98425507-98425529 ACTCACTTAAGGTAGAGGGGTGG + Intronic
977624641 4:99176986-99177008 ATAAACTCAAAGTAAAGGGATGG - Intergenic
977635720 4:99295588-99295610 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
977643166 4:99380190-99380212 ATAGATTTAAAGTTAAGGGGTGG + Intergenic
977746976 4:100560536-100560558 AAGAACTTAAAGTAAAGGAGTGG + Intronic
977762960 4:100761160-100761182 ATAAACTTAGGGTAAAGGGGTGG + Intronic
977826254 4:101535278-101535300 ATATATTTAAGGTACAGAGGTGG + Intronic
977828933 4:101566765-101566787 ATAAACTTAAGGTAAAGTGATGG + Intronic
978027777 4:103898790-103898812 ATATAATCAAGGTAAAGGAGTGG + Intergenic
978143036 4:105339270-105339292 ATAAAATTAAGTTAAATGGCTGG - Intergenic
978288421 4:107107445-107107467 ATAGACTCAAAATAAAGGGGTGG + Intronic
978316745 4:107446505-107446527 TCAAACTTAAGGTAAAGGGATGG - Intergenic
978726481 4:111975786-111975808 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
978762029 4:112363336-112363358 ATAAACTTAAGGTAAAGGGGTGG + Intronic
978899678 4:113931985-113932007 ATAAACTGAAAGCAAAGGAGTGG + Intronic
978916322 4:114129647-114129669 ATAAACTTAGGGTAAAGGGGTGG + Intergenic
978925116 4:114233447-114233469 ATAAACTTAAGGTAAAGGGATGG + Intergenic
978999235 4:115197598-115197620 ATAAACTTAAACTAAAGGGGTGG - Intergenic
979020520 4:115491005-115491027 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
979029987 4:115631692-115631714 ATAAACATAAGGTAAAGGAGTGG - Intergenic
979046389 4:115871325-115871347 ACAAATTCAAAGTAAAGGGGTGG - Intergenic
979159826 4:117446179-117446201 ATAAACTTAAAGTAAAGGCGGGG - Intergenic
979165263 4:117520959-117520981 ATAAACTCAAAATAAAGGGATGG - Intergenic
979195233 4:117913396-117913418 ATAAACTCAAGGTAAAGGGGTGG - Intergenic
979202018 4:117989761-117989783 ATAAATTTAAGGTAAAGGAGTGG + Intergenic
979357182 4:119717993-119718015 ATAAACTTAAGGTAAGGGGGTGG + Intergenic
979381893 4:120016554-120016576 ATAAACTTAAAGTAAAAGGGTGG - Intergenic
979434937 4:120676602-120676624 ATACACTCAAAGTAAAGAGGTGG + Intergenic
979461731 4:120991501-120991523 AGAAACTTAAGGTAAAGGGGTGG - Intergenic
979498930 4:121416997-121417019 ATGAACTTAAGGTAAAGGGGTGG - Intergenic
979705085 4:123711352-123711374 ATAAACTAAAAGTTAAGGGATGG + Intergenic
979794730 4:124832924-124832946 ATAAACTTAAAATAAAGGGGTGG - Intergenic
979794740 4:124833089-124833111 ATAAACTTAAAATAAAGGGGTGG - Intergenic
979914873 4:126418976-126418998 ATAGACTGAAGGTAAAGGGATGG - Intergenic
980033607 4:127858432-127858454 ATAAACTTTAGTTAAAGGAGTGG + Intergenic
980087595 4:128407749-128407771 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
980108892 4:128615607-128615629 ATAAACTTAAAGTAAAGAAATGG + Intergenic
980153016 4:129071659-129071681 ATAAACTTAAAGTGAAGGGGTGG - Intronic
980186877 4:129473499-129473521 GTAAGCTTAAGATAAAGGGGTGG - Intergenic
980366934 4:131816805-131816827 ATAGACTCAAGGTAAGGGGGTGG - Intergenic
980409775 4:132402094-132402116 ATAAACTTCAAGTAAAGGTGTGG - Intergenic
980519123 4:133908323-133908345 GTAAACTTAAGGTATAGGGGTGG - Intergenic
980536394 4:134128954-134128976 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
980580310 4:134741914-134741936 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
980644903 4:135631267-135631289 ATAAACTTAAGATAAAGGGGTGG - Intergenic
980761214 4:137236903-137236925 ATAAACTTAAGGTAAAGAGATGG - Intergenic
980860879 4:138498214-138498236 ATAAACTTACAGTAAAGAGGTGG - Intergenic
981139353 4:141250858-141250880 ACAGACTCAAGGCAAAGGGGTGG - Intergenic
981167886 4:141583324-141583346 ATAAACTTAAGATAAAGGGGTGG + Intergenic
981177505 4:141699686-141699708 ATAAACTTAAGGGAAACAGGTGG - Intronic
981280211 4:142948417-142948439 ATAAGCTCAAAGTAAAGGGATGG + Intergenic
981333596 4:143541218-143541240 ATAAAATTCAAGAAAAGGGGTGG + Intronic
981461571 4:145018726-145018748 ATAAACTTAAAGTAAAGGAGTGG + Intronic
981825044 4:148930405-148930427 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
982119410 4:152127202-152127224 ACAAACTTAAGGTAAAGGGGTGG - Intergenic
982299331 4:153863270-153863292 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
982451241 4:155554385-155554407 ATAAACCTAAGGTAAAGGGGTGG + Intergenic
982451250 4:155554480-155554502 ATAAACCTAAGGTAAAGGGGTGG + Intergenic
982451259 4:155554575-155554597 ATAAACCTAAGGTAAAGGGGTGG + Intergenic
982487152 4:155979763-155979785 ACAGACTTAAGGTAAAGGGGTGG - Intergenic
982491955 4:156040508-156040530 AGAAACTTAAGGTAAAGGGGTGG + Intergenic
982829945 4:160046451-160046473 ATAAACTTAAGGTAAAGGGATGG + Intergenic
982991991 4:162287988-162288010 GTAAACTTAAGGTAAATGGGTGG + Intergenic
983036038 4:162866940-162866962 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
983161537 4:164421917-164421939 ATAAACTGAAAGTAAAGGAATGG + Intergenic
983329277 4:166303614-166303636 ATAAACCTAAGGAAAAGGGATGG + Intergenic
983455679 4:167960669-167960691 ATAAACTAAAAGAGAAGGGGTGG + Intergenic
983477340 4:168230000-168230022 ATAAATTTAAGGGAAAGGGGTGG + Intronic
983544676 4:168950950-168950972 ACAAACTTAAAGTAAAGCGGGGG - Intronic
983729665 4:170977533-170977555 ATAAACTTACAGTAAAAGAGTGG - Intergenic
983749701 4:171251187-171251209 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
983754844 4:171322047-171322069 AGAAACTTAAGGTAAAGGTGTGG + Intergenic
983807638 4:172015407-172015429 ACAAACTTAAGGTAAAGGGTTGG - Intronic
983826074 4:172262484-172262506 ATAAATTTAAGGTAAAGGGGTGG - Intronic
983845399 4:172512300-172512322 ATAAACTTAAGGTAAGGGGGTGG - Intronic
983894359 4:173066312-173066334 TTAAATATAAGGTAAAGGGGTGG - Intergenic
983962883 4:173776181-173776203 AGAAACTTAAGGTAAAGAGGTGG - Intergenic
984066713 4:175056948-175056970 ATAAACTTTAGGTAAAGGAGTGG + Intergenic
984266458 4:177503289-177503311 ATAAACTTAAAGTAAAGGAGTGG - Intergenic
984474936 4:180224073-180224095 ATAAACTTAAGGTAAAGGGATGG - Intergenic
984721926 4:182980528-182980550 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
984995647 4:185427461-185427483 TTAAATTTAAGGTAAAAGGCCGG + Intronic
985093104 4:186383715-186383737 ATACACTTGAAGTAAAGGGGTGG + Intergenic
985240605 4:187927613-187927635 ATCAACTTAAGGTAAATGGGTGG - Intergenic
985326254 4:188774313-188774335 ATAAACTTAAGATAAAAAGGTGG - Intergenic
985355941 4:189118937-189118959 ATAAACTTAAGGTAAATGGGTGG + Intergenic
985394557 4:189528374-189528396 ATTAACTAAAGGTAAACGAGTGG - Intergenic
986162872 5:5247197-5247219 TTAAACTTCAGCTAAAGGGTTGG + Intronic
986259196 5:6128097-6128119 GTAAACTTAAGGTAAAGGGGTGG + Intergenic
986617675 5:9636789-9636811 ACTCACTTAAGGTAAAGGGGTGG - Intronic
986634229 5:9804019-9804041 ATAAACTTAAGGTAAAGGGGAGG + Intergenic
986870426 5:12038612-12038634 ATCAACTTAAAGTACAGGGGTGG + Intergenic
986915923 5:12620903-12620925 ATAGACTCAAGGTAAAGGAGTGG - Intergenic
987030212 5:13970154-13970176 ATACATTTAAGGTAAAGGGGTGG - Intergenic
987365227 5:17142600-17142622 ATAGACTTAAATTAAAGAGGAGG + Intronic
987436665 5:17903748-17903770 ATAAACTTAAGGTAATGGGATGG - Intergenic
987563744 5:19557413-19557435 ATATACTTAAAATAAAGGGGTGG + Intronic
987898376 5:23978771-23978793 AGAAACTTGAAGTAAAGGTGTGG + Intronic
987935853 5:24463771-24463793 ATGAACTTAAGATACAGGGAGGG + Intergenic
988002391 5:25365017-25365039 ATAAACATAAGGTAAAGGGGTGG + Intergenic
988316774 5:29641378-29641400 ATTAACTGAAGGAAAATGGGCGG + Intergenic
988344805 5:30022946-30022968 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
988421009 5:31006258-31006280 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
988652178 5:33164981-33165003 ATAAACTTAAGATAAAGGGATGG - Intergenic
988654591 5:33195033-33195055 ATAGACTCAAAGTAAAGGGATGG - Intergenic
988876088 5:35447503-35447525 ATAAACTTAAGGTAAAGAGATGG + Intergenic
988889698 5:35601362-35601384 ATAAACTTAAGCTAAAGAGGTGG + Intergenic
989010884 5:36871541-36871563 GTAATCTTAAGGCAAAGGGTAGG - Intergenic
989027543 5:37084889-37084911 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
989215220 5:38898457-38898479 ATAGACTGAAGATAAAGGGATGG - Intronic
989355286 5:40537510-40537532 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
989481176 5:41931964-41931986 CAAAACTCAAGGTAAAGAGGTGG - Intronic
989525704 5:42451767-42451789 ATAAACTTAAGGTAAAGAAGTGG - Intronic
989533608 5:42538019-42538041 ATAAACTTAAAGTAAAGGGGTGG - Intronic
989562583 5:42869021-42869043 GTAAACTTAAGGTAAAGAGGTGG - Intronic
989608515 5:43269385-43269407 ACAAGCACAAGGTAAAGGGGTGG - Intronic
989768270 5:45112263-45112285 ACAAAATTAAAGTACAGGGGTGG + Intergenic
989818091 5:45761222-45761244 ATAAACTTAAGGTAAAGGAGTGG - Intergenic
990233539 5:53741129-53741151 ATAAGCTTAAAGTAAAGGGGTGG + Intergenic
990243741 5:53841027-53841049 CATAACTTAAGGTAAAGGGGTGG + Intergenic
990572967 5:57097204-57097226 ACAAACTTAACGTAAAGGGGTGG + Intergenic
990775931 5:59306250-59306272 ATAAACTTAAAGTAAAGGGGTGG - Intronic
990899541 5:60735724-60735746 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
991414934 5:66382310-66382332 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
991543359 5:67753929-67753951 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
991623176 5:68567449-68567471 ATAAACTTAAGATAAAGGGGTGG + Intergenic
991924077 5:71686215-71686237 ATAAACTTGAGGTGAAGGGGTGG + Intergenic
992012845 5:72547217-72547239 ATAAACTGAAAATAAAGGGGTGG - Intergenic
992339890 5:75812722-75812744 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
992576685 5:78120469-78120491 ATAAACTCAAAATAAAGGGATGG + Intronic
992898839 5:81272210-81272232 ATAAACTTAAGGTAAAGGAGTGG + Intergenic
993138839 5:84003952-84003974 ATAAACTCAAGGTAAAAGAATGG + Intronic
993250137 5:85511472-85511494 ATAAACTTAGAGTAAAGTGGTGG - Intergenic
993269269 5:85773034-85773056 ATAAATTCAAGGTGAAGAGGTGG - Intergenic
993606918 5:90002336-90002358 ATTAATTTAAGGTGAAGGGATGG + Intergenic
993634673 5:90329478-90329500 ATATACTGAAAGTAAAGAGGTGG - Intergenic
993883688 5:93392949-93392971 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
993948371 5:94142408-94142430 ATAAACTTAATGTAAAGAGATGG - Intergenic
993960693 5:94293993-94294015 ATAAACTCAAAATAAAGGGATGG - Intronic
994028958 5:95118660-95118682 ACAGACTGAAAGTAAAGGGGTGG + Intronic
994051114 5:95363862-95363884 ATAAACTTAAGGTAGAGGGGTGG - Intergenic
994304235 5:98182514-98182536 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
994330072 5:98494105-98494127 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
994347407 5:98702793-98702815 ATAAACTTAACGTAGAGGTGTGG + Intergenic
994358170 5:98818596-98818618 ATAAACTTAAGGTAAATGGGTGG + Intergenic
994398898 5:99254696-99254718 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
994527378 5:100923734-100923756 ATAAACTTAAGGTAAAGTGGTGG - Intergenic
994550478 5:101228953-101228975 GTGAACTCAAGGTAAAGGGGTGG - Intergenic
994707819 5:103226912-103226934 ATAGGCTCAAAGTAAAGGGGTGG + Intergenic
994777969 5:104059640-104059662 ATACACTTAAGGTAAAGGGGTGG - Intergenic
994823092 5:104678667-104678689 ATAAACTTAAGGTAAAGGTGTGG + Intergenic
994887549 5:105583600-105583622 ATGAACTTAAGATAAAGGGGTGG + Intergenic
995317704 5:110795487-110795509 AGAAACTTAAAGTAAAGGGGTGG - Intergenic
995450951 5:112300006-112300028 ATAAACTTGAGATAAAGGGATGG - Intronic
995694396 5:114863929-114863951 ATAAACTTAAGGTAAAGGGATGG - Intergenic
995699124 5:114914200-114914222 GTACACTTAAGGTAAAGGGATGG + Intergenic
995722713 5:115153166-115153188 AAAAACTTAAGGTAAAGGGGTGG + Intronic
995793581 5:115919217-115919239 ATAAAATTGAGGTAAGAGGGAGG + Intergenic
995811508 5:116112328-116112350 ATAGACTAAAAGTAAAGGGGTGG - Intronic
995818022 5:116193454-116193476 ATAAACTGAAAGTAAAGGGGTGG + Intronic
996010959 5:118480972-118480994 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
996066777 5:119088309-119088331 ACAGACTGAAAGTAAAGGGGTGG - Intronic
996110364 5:119558654-119558676 ATAAACATAAGGTAAATGGGTGG + Intronic
996121372 5:119676930-119676952 ATAGGCTTAAAGTAAAGGGATGG - Intergenic
996197994 5:120633500-120633522 ATAAACTTAAGGTAAAGGGGTGG + Intronic
996427290 5:123328502-123328524 ATAAATTTAAGGTAAAGGAGTGG - Intergenic
996608816 5:125355655-125355677 ATAGACTTAAGGTAAAGGGATGG - Intergenic
996678534 5:126204117-126204139 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
996694725 5:126381550-126381572 ATAAACCCGAGGTAAAGGGATGG - Intronic
996835201 5:127783995-127784017 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
996875180 5:128233298-128233320 ATAAACTTAAGGTAAAGTGGTGG - Intergenic
996902092 5:128554005-128554027 ATAAACTCAAAATAAAGGGATGG + Intronic
996930484 5:128880493-128880515 ATTAACATGAGGTAAAGGTGAGG + Intronic
997003884 5:129796097-129796119 AGAAAATTAAGGTAAAGTGGTGG - Intergenic
997058632 5:130475240-130475262 AGAAATTTAAGGTAAAGGGGTGG - Intergenic
997105770 5:131017934-131017956 ATAAACTTAAGAAAAAGGGATGG - Intergenic
997765374 5:136498228-136498250 ACACATTTAAGGTAAAGGTGAGG - Intergenic
997798150 5:136832279-136832301 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
997901056 5:137764790-137764812 ATAAACTTGAGGTAAAGAGGTGG + Intergenic
998008405 5:138673244-138673266 ATAAACTCAAAGTAGAGGGAAGG - Intronic
998746262 5:145262968-145262990 ATAAACTTAAGGATAAGGGGTGG + Intergenic
998758796 5:145409501-145409523 ATAAACTTAAGGCAAAGGGGTGG + Intergenic
998777028 5:145615268-145615290 ATAAACTTAAAGTAAAGGGGTGG - Intronic
998941078 5:147282570-147282592 ATAAACATAAAGTAAAGGTGTGG + Intronic
999086301 5:148893677-148893699 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
999108867 5:149097768-149097790 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
999660238 5:153854482-153854504 ATAGACTAAAAGTGAAGGGGTGG - Intergenic
999677289 5:154016907-154016929 GTAAGCTTAAGGTAAAGGGGTGG + Intronic
999801070 5:155037229-155037251 ACAAACTTAAGGTAAAGAGTTGG - Intergenic
999913170 5:156228502-156228524 ATAAACTTGAGGTAAAGAAGTGG - Intronic
1000158859 5:158580028-158580050 ATAAAGTTAAGGTAAAGGGGTGG - Intergenic
1000237865 5:159379420-159379442 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1000264681 5:159623595-159623617 ACAAACTTAAGATAAAGGGATGG + Intergenic
1000394842 5:160762842-160762864 ATAAACTTAAGATAAAGGGATGG + Intronic
1000511417 5:162188362-162188384 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1000525405 5:162351748-162351770 ATAAGCTTAAGGGAAAGGACTGG - Intergenic
1000882159 5:166710835-166710857 ATAAATAAAAGGTATAGGGGTGG + Intergenic
1001166876 5:169376658-169376680 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1001290906 5:170458989-170459011 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1001733559 5:173979664-173979686 ATAAACTTAAGGTAAAGGAGTGG - Intronic
1002743884 5:181455346-181455368 AAAAACTTAATGGAAAGAGGAGG + Intergenic
1002814067 6:661932-661954 ATAAAGTTAAAGTAAAGGGGTGG + Intronic
1003029225 6:2587434-2587456 ATAAACTTAAAGTAAAAGGGTGG - Intergenic
1003451085 6:6232230-6232252 ATAAACTTAAAGTAAAGGTGTGG + Intronic
1003465149 6:6372377-6372399 ATAAACTTAAGGCTAAGGGGTGG + Intergenic
1003582218 6:7350037-7350059 ATAAACTTAAAGTAAAGGGGTGG + Intronic
1003930213 6:10917507-10917529 ATAAACTTAAGGTAAAGGCGTGG - Intronic
1003932322 6:10936725-10936747 ATAAACTGAAAGTGAAGGGTCGG + Intronic
1003932871 6:10943456-10943478 ATAAAATTAAGGGGAGGGGGTGG - Intronic
1004096773 6:12562795-12562817 ATAAACTTAATATAAAGGGATGG + Intergenic
1004600288 6:17143291-17143313 ACTCACATAAGGTAAAGGGGTGG - Intergenic
1004888737 6:20076710-20076732 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1005107540 6:22240735-22240757 ATAAACTTAATGTAAAGGGGTGG + Intergenic
1005244293 6:23863953-23863975 ATAAGCTTAAGGTAAAGGGGTGG + Intergenic
1005259274 6:24040729-24040751 ATAAACTTAAGATAAAGGAATGG - Intergenic
1005305540 6:24510665-24510687 AGAAACTTAAGGTAAAGGGGTGG - Intronic
1005395158 6:25374880-25374902 ATAGACTCCAGGTAAAGTGGTGG - Intronic
1005431273 6:25759734-25759756 ATAAACTTAAGGTAAAGAGGTGG - Intronic
1005691335 6:28309590-28309612 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1005793704 6:29334057-29334079 ATAGACTCAAGGTAAAGGGTAGG + Intergenic
1005929509 6:30472887-30472909 ACAAACTTAAGATAAAGTGATGG + Intergenic
1006062779 6:31437582-31437604 ATAAACTGAAGGTAAAGGGGTGG - Intergenic
1006286468 6:33098755-33098777 AAAAACTTAAGGTAAAGGAGTGG + Intergenic
1007815356 6:44520507-44520529 ATAGACTGAAAGTAAAGGGATGG - Intergenic
1007891098 6:45292613-45292635 ACAAACTTAAGGCAGAGGGGTGG + Intronic
1008010717 6:46465029-46465051 ATAAACATAATAAAAAGGGGAGG + Intronic
1008042084 6:46813181-46813203 ATAAACTTAAGGTAAAGGAGTGG - Intronic
1008171889 6:48217970-48217992 ATAAATTTAAGGTAAAGGGGTGG + Intergenic
1008215326 6:48781155-48781177 ATAAACTGAAAGTAAAGTGATGG + Intergenic
1008305517 6:49894181-49894203 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1008351945 6:50501713-50501735 ATAGACTGAAAGTAAAGGGATGG + Intergenic
1008402839 6:51084027-51084049 ATAGACTTAAAATAAAGGGATGG - Intergenic
1008528426 6:52432058-52432080 GTAAATTTAAGGTAAAGGGGTGG - Intronic
1008775216 6:55030229-55030251 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1008882720 6:56397097-56397119 ATAAACTCAAGGTAAAGGGATGG + Intergenic
1008914582 6:56773525-56773547 CTAAGCATAAGGTAATGGGGAGG + Intronic
1008992668 6:57620859-57620881 ATAAACTTAAAGTAAAGATGTGG + Intronic
1009181290 6:60519970-60519992 ATAAACTTAAAGTAAAGGTGTGG + Intergenic
1009267280 6:61571199-61571221 ATAAACTTATGGTAAAGGGGTGG + Intergenic
1009329504 6:62399010-62399032 ATAAACTGAAAATAAAGGGATGG - Intergenic
1009332311 6:62439361-62439383 ATAAACTTAAGGTGAAGGGGTGG - Intergenic
1009389516 6:63129098-63129120 ATAAACTTAAGGTAAGGGGATGG - Intergenic
1009526527 6:64753396-64753418 TCAGACTCAAGGTAAAGGGGTGG + Intronic
1009644493 6:66380067-66380089 ATAAACTTAAGGTATAGGTGTGG + Intergenic
1009710533 6:67312320-67312342 ATAGACGCAAGGTAAAGGAGTGG - Intergenic
1009847115 6:69147993-69148015 ATAGACTGAAAGTAAAGGGATGG - Intronic
1009849541 6:69178296-69178318 ATAACCTCAAAGTAAAGGGTTGG - Intronic
1009867101 6:69411021-69411043 ATAAACTTAAGGAAAATGAATGG + Intergenic
1009875674 6:69501685-69501707 ATAGACTGAAAGTGAAGGGGTGG + Intergenic
1009969041 6:70606801-70606823 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1010008805 6:71027048-71027070 ATAAACTGACAGTAAAGGGTTGG - Intergenic
1010017213 6:71119321-71119343 ATAAACGTAAGGCAAAGGAGTGG - Intergenic
1010054958 6:71554755-71554777 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1010076164 6:71801531-71801553 ATAATCTTAAAGTAAAGGGGTGG - Intergenic
1010164896 6:72904216-72904238 TTAAACTTAAAGGAAAGGGGTGG - Intronic
1010181695 6:73094260-73094282 ACAAACTTAAGGTAAAGGTGTGG - Intronic
1010458989 6:76092020-76092042 ACAAACTTAAGGTAAAGAGGTGG - Intergenic
1010479672 6:76336228-76336250 ATAAACTTAATGTAAAAGGGTGG - Intergenic
1010518272 6:76801390-76801412 ATAAACTTAAGGTAAAGAGGTGG - Intergenic
1010633491 6:78229199-78229221 ATAAACTTAAGGTAACAGGGTGG - Intergenic
1010707573 6:79133287-79133309 GTAAACTTAAGGTAAAGGGATGG - Intergenic
1010801688 6:80184303-80184325 ATAAACTTAAGGTAAAGGGATGG - Intronic
1010862862 6:80935620-80935642 ATAAACTTAAGGTAAAAGGTTGG - Intergenic
1010901994 6:81439114-81439136 ACAAACTGAAAGTAAAGGGATGG - Intergenic
1011005447 6:82639393-82639415 ATAAACTTCAGGTGAAGGGGTGG + Intergenic
1011093307 6:83631696-83631718 ACAAACTTAAGGTAAAGGGGTGG - Intronic
1011132930 6:84070925-84070947 AAAAACTTAAAGTAAAGGGGTGG - Intronic
1011168836 6:84481273-84481295 ATAAACTTAAAATAAAGGGGTGG + Intergenic
1011225375 6:85099165-85099187 ATTAACTTAAGGTAAAGGGGTGG + Intergenic
1011327350 6:86163743-86163765 ATAAACTTAAAGTATAGGGGTGG + Intergenic
1011328879 6:86182038-86182060 ATAAACTTAAAGTAGAGGGATGG - Intergenic
1011365901 6:86582457-86582479 ATAAACCTAAGCTAAAGGGGTGG - Intergenic
1011373271 6:86663586-86663608 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1011394817 6:86895136-86895158 AGAAACTTAAGGTAAAGGGATGG + Intergenic
1011587109 6:88938391-88938413 ATAGACTGAAAGTAAAGGGATGG - Intronic
1011789522 6:90883636-90883658 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1011817653 6:91211720-91211742 ATAAACTTAAAGTAAAGAGGTGG - Intergenic
1011833913 6:91406323-91406345 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1011871210 6:91895469-91895491 ATAATCTAAAGGCACAGGGGGGG - Intergenic
1011923778 6:92616446-92616468 ATAAACTTAAAATAAAGGGGTGG - Intergenic
1011956884 6:93034281-93034303 ATAAGCTCAAAGTAAAGGGATGG + Intergenic
1011965628 6:93154400-93154422 AAAAACTAAAGGTGAAGGAGTGG - Intergenic
1012079634 6:94739044-94739066 ATAAAAGTAAGGTAAATGGGTGG + Intergenic
1012156160 6:95821817-95821839 ATAAACATAAAGTAATGGGGTGG + Intergenic
1012203210 6:96432142-96432164 ATAAACTTAAGGTAAAGAGGTGG - Intergenic
1012204576 6:96444512-96444534 ATAATCTTAAGGTAAAGGGGTGG + Intergenic
1012238516 6:96845672-96845694 ATAGACTCAAAGTAAAGGGTTGG + Intergenic
1012273377 6:97242457-97242479 CATAACTTAAGGTAATGGGGTGG - Intronic
1012299045 6:97561868-97561890 ATAAACTTAAGGTAAAAGAGTGG - Intergenic
1012415656 6:99010283-99010305 ATAAACCTAAGGGAGTGGGGAGG + Intergenic
1012567400 6:100675790-100675812 AGAAACATACGGTAAAGGGATGG + Intronic
1012571952 6:100740762-100740784 ATAAACTCAAAATAAAGGAGTGG - Intronic
1012684794 6:102232552-102232574 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1012717342 6:102692730-102692752 ATAAACCTAAGGTAAAAAGATGG - Intergenic
1012793998 6:103736543-103736565 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1013383578 6:109601940-109601962 ATAAGCTTAAAATAAAGGGATGG - Intronic
1013852443 6:114532793-114532815 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1013856907 6:114583516-114583538 CAAAACTTAGGGTAAAGGGGTGG + Intergenic
1013946245 6:115726431-115726453 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1013983668 6:116164448-116164470 ACAAGCTCAAAGTAAAGGGGTGG - Intronic
1014285242 6:119489453-119489475 ATAAACTTAAAGTAAAGGGGCGG + Intergenic
1014337030 6:120149330-120149352 ATAAACTTAAAATAAAGGGGAGG + Intergenic
1014378690 6:120711518-120711540 ATAAACTGAAAATAAAGGGATGG + Intergenic
1014420107 6:121233569-121233591 ATAAACTTAAGATAAAGGGGTGG - Intronic
1014531186 6:122561776-122561798 ATGAACTTAAAGTAAAGGGGTGG - Intronic
1014532228 6:122572018-122572040 ATAAACTCATGGTTAAGGGGTGG + Intronic
1014532236 6:122572074-122572096 ATAAACTCATGGTAAAGGGGTGG + Intronic
1014581574 6:123143871-123143893 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1014629861 6:123774916-123774938 ATAGACTTACGGAAAAGGAGAGG - Intergenic
1014658443 6:124135404-124135426 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1014739235 6:125127727-125127749 ATAAACTTAAAGAAAAGGGGTGG + Intronic
1014749752 6:125242652-125242674 ATCAACTTAAGGTAAAGAGGTGG - Intronic
1014792583 6:125691488-125691510 ATAAACTTAAGGTAGTGGAGTGG - Intergenic
1014878217 6:126687399-126687421 ATCAACTTAAGGTAAAGGAGTGG + Intergenic
1015289092 6:131518124-131518146 ACAAACTCAAAGTAAAGGAGTGG - Intergenic
1015348060 6:132182522-132182544 ATAAACTTAAGCTAAAGGGGTGG + Intergenic
1015362169 6:132353001-132353023 ATAAACTTAAAGTAAAGGGGTGG - Intronic
1015565783 6:134569200-134569222 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1015663109 6:135598586-135598608 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1015900055 6:138055237-138055259 GTAAATTCAAGGTAAAGGGATGG + Intergenic
1015929956 6:138349199-138349221 ATAATCTTAAGGAAAATGGCAGG + Intergenic
1016018115 6:139206776-139206798 ATAGACTTAAGGTAAAGGGGTGG + Intergenic
1016176083 6:141078993-141079015 ATAAATTTTAGGTAAAGGGGTGG + Intergenic
1016197253 6:141359655-141359677 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1016289764 6:142516470-142516492 ACTCACTTAAGGTAAAGGGGTGG - Intergenic
1016425396 6:143931166-143931188 ATAGACTTAAGGTAAAGGAGTGG - Intronic
1016900790 6:149099283-149099305 ATAAACTAAAAGTAAAGGGGTGG + Intergenic
1016909932 6:149188645-149188667 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
1016959805 6:149662494-149662516 ATAAATATATGGTACAGGGGAGG - Intronic
1017214743 6:151897543-151897565 ATAAACTTAAGGTAAGGGTGTGG - Intronic
1017318895 6:153065080-153065102 ATAGACTTAAAATAAAGGGATGG + Intronic
1017933930 6:158987324-158987346 ATAGACTGAAAGTAAAGGGATGG - Intronic
1018052045 6:160018140-160018162 ATACACTGAAGCTAAAGGGATGG + Intronic
1018113479 6:160559693-160559715 ATAAACTTAAAGTAAATGGGTGG - Intronic
1018133929 6:160760065-160760087 ATAAACTGAAAGTAATGGGATGG + Intergenic
1018596964 6:165491031-165491053 ATAAACTTAGAGTAAAGGGGTGG + Intronic
1018755468 6:166844992-166845014 ATAAACTTAAGATAAAGAGGTGG + Intronic
1018781584 6:167072367-167072389 ATAAACTTATGATAAAGGGGTGG - Intergenic
1019108903 6:169693613-169693635 ATAAACTTAAGGTAAAGGAGAGG + Intronic
1019122900 6:169818750-169818772 ATAAACTTAAGGTAAATGGGTGG - Intergenic
1019248743 6:170728575-170728597 AAAAACTTAATGGAAAGAGGAGG + Intergenic
1019865611 7:3707916-3707938 AAAAACTCAAGGTAAGGGGATGG - Intronic
1020332176 7:7030607-7030629 ATAAACTTAAGGTAAATGAGTGG - Intergenic
1020423550 7:8037674-8037696 AAAGACTCAAGGTAAAGGGGTGG + Intronic
1020450121 7:8312176-8312198 ACAGACTCAAGGTAAAGGGGTGG - Intergenic
1020635101 7:10686838-10686860 ATAAACTTAAGGTAAATGGTTGG + Intergenic
1020975031 7:14995505-14995527 ATAACCTTAAAGAAAAAGGGGGG - Intergenic
1021081722 7:16372816-16372838 ATAAACTTAAGGTAAAGAGGTGG + Intronic
1021204489 7:17763677-17763699 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1021769846 7:23987573-23987595 GTAGACTCAAGGTAAAGGAGTGG + Intergenic
1022564962 7:31390195-31390217 ATAAACTTAAGGTAAAGAGGTGG - Intergenic
1022890432 7:34691492-34691514 ATAGACTCAAAGTAAAGGGGTGG + Intronic
1023509966 7:40941927-40941949 ATAGATTCAAGGTAAACGGGTGG - Intergenic
1023657441 7:42439081-42439103 ATTAACTTAAGGTAAAGGGATGG - Intergenic
1024021109 7:45371520-45371542 ATAGACTTAAAGTGAAGGGATGG - Intergenic
1024174941 7:46829483-46829505 ACAAACTTAAGGTAAAGGGGTGG + Intergenic
1024367108 7:48533857-48533879 ATAAGCTTAAGGTAAAGGGGTGG - Intronic
1024455951 7:49606856-49606878 ATAATCTCAAGGTAAAGGGGTGG + Intergenic
1024665424 7:51542232-51542254 ATAAACTGAAGGTAAAAGCATGG - Intergenic
1024745165 7:52398109-52398131 ATAAACTTAAAATAAAGGGATGG - Intergenic
1024782509 7:52867415-52867437 ATAAACTCAAGGTAAATGGGTGG + Intergenic
1024840218 7:53576782-53576804 ACAAACTTAAGGTAAAAGTGTGG + Intergenic
1024847615 7:53666453-53666475 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1024863245 7:53871249-53871271 ATAGACTCAAGGTAAAGGGGTGG + Intergenic
1024876026 7:54024710-54024732 ATAAAATTAAGGTAAAGGAGTGG - Intergenic
1024893504 7:54229477-54229499 ATAAACTCAAGGTAAAAGGGTGG + Intergenic
1024900414 7:54312910-54312932 ATAAACTCAAGGTAAAAGGGTGG - Intergenic
1024998281 7:55292785-55292807 ATAGGCTTAAAATAAAGGGGTGG - Intergenic
1025772973 7:64530441-64530463 ATAAAATTAAAGTAAAGGGGTGG + Intronic
1025794598 7:64727513-64727535 ATAAACTTAAGGTAATGAGGTGG - Intergenic
1025807365 7:64847715-64847737 ATAAACTTAAGGTAATGGAGTGG - Intergenic
1025820807 7:64961274-64961296 ATAAACTTAAGGTATTGGGGAGG + Intergenic
1027295577 7:76766031-76766053 ATAAACTTCAAGTAAAGGGGTGG + Intergenic
1027334648 7:77135795-77135817 ATAAATTAAAAGTAAATGGGTGG + Intronic
1027417449 7:77988418-77988440 ATAAACTTCAAGTAAAGGAGTGG - Intergenic
1027562995 7:79755974-79755996 ATAAACTTAAGGTGAAGGGGTGG - Intergenic
1027691516 7:81352814-81352836 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1027838394 7:83276482-83276504 GTAAATTCAAGGTAAAGAGGTGG - Intergenic
1027948318 7:84779897-84779919 GTAAATGTAAGGTAAAGGGGTGG + Intergenic
1027963675 7:84979195-84979217 ACAAACTTAAGGTAAAGGGGTGG - Intergenic
1028054049 7:86221880-86221902 ATAAGCTCAAAGTAAAGGGATGG + Intergenic
1028182816 7:87746675-87746697 ATAAACTTAAAGTAAAGGGGTGG - Intronic
1028347883 7:89806091-89806113 ATAAACTTAAGGTAAAGGAGTGG - Intergenic
1028502075 7:91529786-91529808 ATAAATTTAAGGTAAAGTGGTGG + Intergenic
1028529448 7:91822799-91822821 ATAAACCTAAGGTAAAGGGGTGG - Intronic
1028783075 7:94759209-94759231 ATAAACTTAAGGTAAAGGTGTGG + Intergenic
1028792732 7:94871816-94871838 ATAAACTTAAGATGAAGGGATGG - Intergenic
1028819319 7:95188344-95188366 ATAAACTTAAGGTAAAGGGGTGG - Intronic
1028822734 7:95231036-95231058 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1028868618 7:95740580-95740602 ATAAGCTCAAAGTAAAGGGCTGG + Intergenic
1028936671 7:96472600-96472622 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1028993253 7:97073326-97073348 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1029053361 7:97713238-97713260 ATAAACTTAAGGTAAATGAGTGG + Intergenic
1029786936 7:102801517-102801539 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1030325405 7:108213547-108213569 ATAAACTTAAAATAAAGGAGTGG + Intronic
1030390249 7:108919200-108919222 ACAAACTTAAGGTAAAGGGGTGG - Intergenic
1030440682 7:109584566-109584588 ACAGACTCAAGGTAAAGGGAGGG + Intergenic
1030456066 7:109775086-109775108 ATAAACTTAAGGTATAGGGGTGG + Intergenic
1030533642 7:110739343-110739365 ATAAACTTAAGGTAAAGGGGCGG + Intronic
1030809079 7:113953667-113953689 ATAGACTTAAAATAAAGGGATGG - Intronic
1030936200 7:115587169-115587191 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1031090239 7:117346107-117346129 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1031147995 7:118018409-118018431 ATGAATTTAACTTAAAGGGGTGG + Intergenic
1031261548 7:119526975-119526997 ATAAACTAAAGATAACAGGGTGG + Intergenic
1031513541 7:122676077-122676099 ACAAACTTAAGGTAAGGGGGTGG + Intronic
1031611760 7:123836441-123836463 ATAAACTTAAGGTAGAGGGGTGG - Intronic
1031655285 7:124347664-124347686 ATGAACTTAAGTTAAAGGTGTGG - Intergenic
1031675976 7:124612387-124612409 ATAAAATTAAGGTAAAGGAGTGG + Intergenic
1031740186 7:125419644-125419666 ATAAACTTAAGATAAAGGGGTGG + Intergenic
1031796723 7:126184600-126184622 GTAAACTGAAGGTAAAGGGGTGG - Intergenic
1031828120 7:126591157-126591179 ATAAGCTTAAGATAAAGAGGTGG + Intronic
1032148468 7:129406068-129406090 ATCAACTTAAGGGAAAATGGCGG - Intronic
1032285478 7:130535897-130535919 AAAAGGTTAAGGTAAAGGGCTGG + Intronic
1032288901 7:130568342-130568364 ATAAACTTAAGGTAAAGGGGCGG + Intronic
1032448717 7:132008025-132008047 ATAAATTTAAGGTAAAGGGGTGG - Intergenic
1032901813 7:136318674-136318696 ATAGACTGAAAGTAAAGGGATGG - Intergenic
1032922432 7:136565170-136565192 ATAAACTTAAGGTAAAGGCGTGG - Intergenic
1032935832 7:136730252-136730274 ATAGACTTAAGCTAAAGAAGTGG + Intergenic
1032948120 7:136874820-136874842 ATACAGTTATGGCAAAGGGGTGG + Intronic
1032975656 7:137219597-137219619 TTAAACTTAATATAAAGGGAAGG + Intergenic
1032999574 7:137489077-137489099 AGAAACATAAGGGAATGGGGTGG - Intronic
1033259172 7:139827321-139827343 GTAAACTTAAAGTAAAGGGGTGG - Intronic
1033623089 7:143079853-143079875 ATAAACTTAAGGTAAAAGGATGG + Intergenic
1033961390 7:146918043-146918065 ATAAACTTAAGGTAAAGGGGTGG - Intronic
1034019755 7:147628754-147628776 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1034058663 7:148065649-148065671 ATAAATGTAAGGTAAAGGAGTGG - Intronic
1034229936 7:149515837-149515859 ACTCACATAAGGTAAAGGGGTGG - Intergenic
1034682991 7:152945173-152945195 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1034705304 7:153137707-153137729 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1035198922 7:157247248-157247270 TTTAACTTAAGGTAAAGGAATGG - Intronic
1035499302 8:78760-78782 AAAAACTTAATGGAAAGAGGAGG - Intronic
1035591252 8:816070-816092 ATAAACTTAAAATAAAGGGGTGG - Intergenic
1036076149 8:5503072-5503094 AGAAACAGAAGGTAAAAGGGTGG - Intergenic
1036108598 8:5873353-5873375 ATAAACTCAAGGTAAAGGGGTGG - Intergenic
1036394180 8:8352847-8352869 ATAAGCTGAAGGTGAAGGGAAGG + Intronic
1036827550 8:11989685-11989707 ACAAACTCAAGGTAAAATGGTGG + Intergenic
1037320633 8:17639123-17639145 ATAAACTTATGGTAAAGGGCTGG - Intronic
1038366960 8:26946297-26946319 ATAAACTTAAAGTAAAGAGGTGG - Intergenic
1039030296 8:33301465-33301487 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
1039123785 8:34177483-34177505 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1039641678 8:39229477-39229499 ATACACTTAAAGTAAAGGGGTGG + Intronic
1039642552 8:39239705-39239727 ATAAACTTAAGGTAAAGGGGTGG + Intronic
1039644427 8:39265360-39265382 ATAAGCTCAAAGTAAAGGGAAGG - Intronic
1039673229 8:39627574-39627596 ATAGATTCAAGGCAAAGGGGTGG - Intronic
1039711932 8:40063485-40063507 ATAGACTGAAGGTAAAGAGGTGG + Intergenic
1039763679 8:40606034-40606056 ATAAACTGAAGGTAAAGGGGTGG - Intronic
1039810308 8:41042170-41042192 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1039811334 8:41051278-41051300 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1040362548 8:46681270-46681292 ATAAACTTCAGGTAAAGGGCTGG - Intergenic
1040529162 8:48251984-48252006 GTAAACTTAAGGTAAAGGGGTGG - Intergenic
1040800447 8:51333627-51333649 ATAAACTTAAAGTAAAGGGGTGG + Intronic
1040820341 8:51548957-51548979 ATAAACTTAAGGCAAAGGGATGG + Intronic
1040867808 8:52068432-52068454 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1040989363 8:53333284-53333306 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1041227978 8:55719003-55719025 ATAAACTTAAAGTAAAGGGGTGG + Intronic
1041296172 8:56359360-56359382 ATAGACTGAAAGTAAAGGGGTGG - Intergenic
1041334684 8:56768214-56768236 ATAAATTAAAAGTAAAGAGGTGG - Intergenic
1041570341 8:59331262-59331284 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1041612067 8:59862660-59862682 ATAAACTAAAAGGAAAGGGTTGG + Intergenic
1041637318 8:60158335-60158357 ATAAACTTAAAGTAAAGGTGTGG + Intergenic
1041827715 8:62116182-62116204 ATAGACTTAAAGTGAAGGGGTGG - Intergenic
1041832223 8:62166828-62166850 ATAAACTGAATGTAAAGGGGTGG + Intergenic
1041897331 8:62940038-62940060 ATAAACTTAAGGTAAAGAGGTGG + Intronic
1041939989 8:63376177-63376199 ATGAACTTAATGTAATGGTGAGG + Intergenic
1042084388 8:65091683-65091705 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1042122622 8:65505238-65505260 ATAAACTTAAAGTAAAGGGCAGG - Intergenic
1042637253 8:70892115-70892137 ATAGACTGAAAGTAAAGGGATGG - Intergenic
1042728833 8:71908701-71908723 GTAAACTTAAGGTAAATGGGTGG - Intronic
1042768239 8:72350859-72350881 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1042995718 8:74695589-74695611 ATAAATTTAAGGTAAAGGGGCGG + Intronic
1043040978 8:75261465-75261487 ACAAACTTAAGGTAAAGGGGTGG + Intergenic
1043048865 8:75360288-75360310 ACCAACTTAAGGTAAAGGGGTGG + Intergenic
1043145057 8:76642656-76642678 ATAAACTGAAAATAAAGGGATGG + Intergenic
1043270901 8:78331558-78331580 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1043340552 8:79232438-79232460 ATAGGCTGAAGGTAAAGGGATGG + Intergenic
1043556528 8:81437130-81437152 ATAAACTTAAGATAAAGAGGTGG - Intergenic
1043638814 8:82422894-82422916 ATAAACTGAAGATAAAGGAGTGG - Intergenic
1043816681 8:84810851-84810873 ATAAACTTAAAGTAAAGGGGTGG - Intronic
1043876174 8:85489393-85489415 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1043988038 8:86716998-86717020 ATAAACTTAAGGTAAAGGGATGG + Intronic
1044227801 8:89738803-89738825 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1044228555 8:89747675-89747697 ATAGACTGAAAGTAAAGGGATGG + Intergenic
1044292081 8:90484120-90484142 ATAAACTTAAGGTAAAGTGGTGG + Intergenic
1044657142 8:94560732-94560754 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1044788056 8:95817290-95817312 ATAAACTTAAGGCAAAGGGGTGG - Intergenic
1044879663 8:96711186-96711208 ATAAACTCAAGGTAAAGGGGTGG - Intronic
1044903528 8:96974149-96974171 GTAAACTTAAGATGAAGGGGTGG + Intronic
1044947683 8:97406221-97406243 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1045095047 8:98788556-98788578 ATAAACTTAAGCTAAAGGGGTGG + Intronic
1045122107 8:99049022-99049044 ATAAACTTAAGGTAAAGGGGTGG - Intronic
1045186842 8:99846758-99846780 ATAAACCTAAGGTAAGGTGATGG - Intronic
1045416377 8:101971863-101971885 ATAAGATGAAGGGAAAGGGGAGG - Intronic
1045634659 8:104170519-104170541 ATAAACTTAAGGTAAAGAGGTGG - Intronic
1045699253 8:104847922-104847944 ATAGACTTAAAATAAAGGGATGG - Intronic
1045780024 8:105851650-105851672 ATAAACTTAAAGTAAAGGGATGG + Intergenic
1045814093 8:106259661-106259683 GTAAACTTAAGGTAAAGGGGTGG - Intergenic
1045878131 8:107006337-107006359 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1046033709 8:108815601-108815623 ATAAACTTAAGGTGAAAGGGTGG - Intergenic
1046284544 8:112077776-112077798 ATAAACTCAAGGTAAAGGAGTGG - Intergenic
1046448839 8:114360324-114360346 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1046567515 8:115919896-115919918 ATAAACTAAAGGAAATGAGGTGG - Intergenic
1046655999 8:116895078-116895100 ATAAGCTGAAAGTGAAGGGGTGG + Intergenic
1046815197 8:118575622-118575644 ATAAAGGAAAGGTACAGGGGAGG + Intronic
1047148024 8:122227646-122227668 ATAAACTCAAGGTAAAAAGGTGG + Intergenic
1047227128 8:122966011-122966033 ATAAACTTAAGGTAAAGGAGTGG - Intronic
1047357022 8:124131630-124131652 ATAGGCTCAAGGTAAAGGGATGG + Intergenic
1047383997 8:124392402-124392424 ATAAACTCAAGGTAAAGGGATGG - Intergenic
1047592205 8:126338483-126338505 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1047607093 8:126486129-126486151 ATAAACTTAAGGTAAAGGGTTGG - Intergenic
1047890250 8:129301080-129301102 ATAAACTTAAGGTAGAGGGGTGG - Intergenic
1047901623 8:129429181-129429203 ATAAACTTAAGGTAAATGAGTGG - Intergenic
1047937225 8:129794611-129794633 ATAAACTCAAGGTAAAGGGGTGG - Intergenic
1047952361 8:129945532-129945554 AGAAACTCAAGGTACAGTGGTGG - Intronic
1048371489 8:133781944-133781966 ATAAACTTAAGGTAAAGGTTTGG - Intergenic
1048515785 8:135109859-135109881 ACAAACTCAAAGTAAAGGGGTGG - Intergenic
1049295778 8:141836233-141836255 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1049897898 9:127540-127562 ATAAACTTAAGGTAAAGGGATGG - Intronic
1049964111 9:763094-763116 ATAAAGTTAAGGCAAAAGGTAGG - Intergenic
1050087810 9:1984791-1984813 ATAAATATAATGTAAAGAGGTGG + Intergenic
1050089902 9:2007448-2007470 ATAAAATATAGGTAAAGGTGAGG + Intergenic
1050133417 9:2437384-2437406 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1050458724 9:5858648-5858670 AAAAGCTTAAGGTAAAAGTGTGG + Intergenic
1050502895 9:6317137-6317159 ATAAAATTAAAGTAAAGGGGTGG + Intergenic
1050903724 9:10977111-10977133 ATAAACTTAAGGTAAAGGAGTGG + Intergenic
1050936090 9:11397224-11397246 ATAAACTTAAGGTTAAGGGGTGG + Intergenic
1050972122 9:11891408-11891430 ATAAACTTAAGATAAATGGGTGG - Intergenic
1051000846 9:12280001-12280023 AAAAACGTAATGTAAAGTGGTGG + Intergenic
1051096719 9:13475163-13475185 ATAGACTCAAAGTAAAGGGATGG - Intergenic
1051277729 9:15413647-15413669 ATAAACTTTAGATAAAGGGGTGG - Intergenic
1051733393 9:20171495-20171517 ATAAACTTAAGGCAAAGGGGTGG + Intergenic
1051816750 9:21117619-21117641 ATAAACTTCAGGTAAAGGGGTGG - Intergenic
1051830927 9:21275567-21275589 ATAAACTCAAAATAAAGGGATGG - Intergenic
1051840177 9:21387602-21387624 ATAGACTGAAGGTAAAGGGATGG - Intergenic
1051881358 9:21843044-21843066 AAAAACTTAAGGTAAAAGGGTGG + Intronic
1051885507 9:21888679-21888701 ATAAACTTAAGGTAAAGCGGTGG - Intronic
1051923541 9:22296454-22296476 ATAAACTTAAAATAAAGAGATGG - Intergenic
1051929660 9:22369271-22369293 ACAAAGTTAAGGTAAAGGGGTGG + Intergenic
1051931360 9:22390064-22390086 AAACACTTAATGTAAAGGAGGGG - Intergenic
1052006468 9:23355807-23355829 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1052053021 9:23870056-23870078 ATAAACTTATGGTAATGGGGTGG + Intergenic
1052307430 9:27026115-27026137 ATAAACTTAAGGTAAAAGGGTGG + Intronic
1052525310 9:29610240-29610262 ATAGACTTCAGGTGAAGGGATGG + Intergenic
1052537329 9:29763428-29763450 ATAAACTTAGAGTAAAGGGGTGG + Intergenic
1052550070 9:29937067-29937089 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
1052624711 9:30960568-30960590 GTTGACTTAAGGTAAAGGGATGG - Intergenic
1052689889 9:31803415-31803437 ATAGACTGAAAGTGAAGGGGTGG + Intergenic
1052731269 9:32289414-32289436 ATAAACTTAAAGTAAAGGGGAGG - Intergenic
1053126754 9:35587294-35587316 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1053297292 9:36923986-36924008 ATAAACTGAGGCTCAAGGGGAGG + Intronic
1053631293 9:39942746-39942768 ATAGACTCAAGGTAAGGGGGTGG - Intergenic
1053740978 9:41137833-41137855 ATAAACTTAAGGTAAAGGGATGG - Intronic
1053774471 9:41520787-41520809 ATAGACTCAAGGTAAGGGGGTGG + Intergenic
1054212594 9:62307952-62307974 ATAGACTCAAGGTAAGGGGGTGG + Intergenic
1054258875 9:62842520-62842542 ATAAACTTAAGGAAAGTGGTAGG - Intergenic
1054443966 9:65293976-65293998 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1054486307 9:65727530-65727552 ATAAACTTAAGGTAAAGGGATGG + Intronic
1054687371 9:68293464-68293486 ATAAACTTAAGGTAAAGGGATGG + Intronic
1054938998 9:70719657-70719679 ATAAACTTAAGGTAAAGGAGTGG + Intronic
1054940689 9:70737650-70737672 ATAAACTTAAGGTAAAGGAGTGG + Intronic
1054941819 9:70751579-70751601 AGAAACGTAAGGAAAAGAGGAGG + Intronic
1055125135 9:72710704-72710726 ATAAAGTTGAGGTAAAAGGGTGG - Intronic
1055156505 9:73068837-73068859 ATAAACTTAAGGTAAACGGGTGG + Intronic
1055186952 9:73468839-73468861 ATAAACTTAGAGTAAAGGGGTGG - Intergenic
1055231483 9:74072183-74072205 ATAAGCTCAAAGTAAAGGGATGG - Intergenic
1055244759 9:74226296-74226318 ATAAACTTAAGGTAAAGAGGTGG + Intergenic
1055846728 9:80573898-80573920 ATAAACTTAAGGCAAATGGGTGG + Intergenic
1055905599 9:81290623-81290645 ATAAACTTAAAGAAAAAGGGTGG - Intergenic
1056025806 9:82494188-82494210 ATAAACTTAGGGTAAAGGGATGG - Intergenic
1056026876 9:82506904-82506926 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1056309634 9:85326306-85326328 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1056396896 9:86189480-86189502 ATAAACTTAAGGTAAGGGGCTGG + Intergenic
1056671868 9:88636911-88636933 ATAAACTTAAGATAAAAGGGTGG - Intergenic
1056696396 9:88858156-88858178 ATAAACTTAAGGTAAAGGGTTGG + Intergenic
1056698841 9:88885262-88885284 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1056948267 9:91019602-91019624 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1057004023 9:91539829-91539851 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1057285516 9:93750373-93750395 ATAAACTCAAAGTAGAGGGGTGG - Intergenic
1057475909 9:95401285-95401307 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1057643080 9:96846472-96846494 ATAAACTCAAGGTAAAGGGAAGG + Intronic
1058156535 9:101522577-101522599 ATAAACTTAAAGTAAAGACGTGG - Intronic
1058233766 9:102463325-102463347 ATAAACTTAAGGTAAAGGTGTGG + Intergenic
1058540499 9:106007494-106007516 ACAAACTTAAGGTAAAGGGGTGG - Intergenic
1058784368 9:108372602-108372624 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1059609382 9:115876477-115876499 ATAAACTTAAAGTAAATGGGTGG - Intergenic
1059673976 9:116518785-116518807 ATAAATGTAATTTAAAGGGGTGG + Intronic
1059891000 9:118803878-118803900 ATAGGCTTAAAGTAAAGGGTTGG + Intergenic
1059960915 9:119563650-119563672 ATAAACTGAAGGCAAACGTGAGG + Intergenic
1060311004 9:122462278-122462300 ATACACTTAAGGTCAAGGGATGG - Intergenic
1060375546 9:123112879-123112901 AGAATATGAAGGTAAAGGGGCGG - Intronic
1062705556 9:137938534-137938556 ATAAACTTAAGGTAAAGGTGTGG + Intronic
1203609701 Un_KI270748v1:85839-85861 AAAAACTTAATGGAAAGAGGAGG + Intergenic
1203631460 Un_KI270750v1:75344-75366 ATAAAATAAAGGAAAAGTGGAGG - Intergenic
1186308618 X:8292090-8292112 ATAAACTTAAGGTAAAAGGATGG + Intergenic
1186460769 X:9746836-9746858 GGAAACTGAAGGCAAAGGGGAGG + Intronic
1187109088 X:16277461-16277483 ATAAACTTAGGGTAAAGGGATGG - Intergenic
1187114877 X:16339250-16339272 ATAAATTTAAAGTAAAGGAATGG - Intergenic
1187218998 X:17305968-17305990 ATAAACTTAAAGTAAAGAGATGG - Intergenic
1187330785 X:18337393-18337415 ATAAACTACAAGTAAAGGGATGG + Intronic
1187615032 X:20983739-20983761 ATAGGCTTAAAGTAAAGGGATGG + Intergenic
1187681583 X:21772404-21772426 ATAAATTTAAAGTAAAGGCATGG + Intergenic
1187838626 X:23461388-23461410 ATAGACTGAAAGTAAAGGGATGG - Intergenic
1187845174 X:23527742-23527764 ATAAACTGAAAATAAAGGGATGG + Intergenic
1188040324 X:25364455-25364477 ACAAACTTAAGGTAAAGGGGTGG - Intergenic
1188059867 X:25588227-25588249 ATAAACTGAAAGTAAAGGGATGG - Intergenic
1188389166 X:29598892-29598914 ATAATCTTAAGGTAAAGGGGAGG - Intronic
1188427762 X:30068597-30068619 ATAGACTAAAAGCAAAGGGGTGG + Intergenic
1188712533 X:33418176-33418198 ATAGACTGAAGGTAAAGGGGTGG + Intergenic
1188719196 X:33502107-33502129 ATAAACTTAAGGTAAAGAGGTGG + Intergenic
1188853967 X:35169375-35169397 ATAAACTGAAAATAAAGGGATGG - Intergenic
1189218369 X:39346889-39346911 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1189564416 X:42226281-42226303 ATAGACTGAAAGTAAAGGGATGG - Intergenic
1189567401 X:42257021-42257043 ATAAACTTAAGGTAAAGGAATGG + Intergenic
1189599952 X:42613648-42613670 ATAAACCTAAGGTAAAGAGGTGG - Intergenic
1189603348 X:42650398-42650420 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1189769398 X:44408555-44408577 AAAAACTTAAGGTAAAAATGTGG - Intergenic
1189878335 X:45461273-45461295 ATAGGCTTAAGGTAAAGGGATGG - Intergenic
1189878952 X:45469333-45469355 ATAAACTTAAAGTAAGGGGGTGG - Intergenic
1189945805 X:46177432-46177454 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1189954515 X:46263649-46263671 ATAAACTCAAGGAAAACGGTAGG + Intergenic
1189962245 X:46334769-46334791 ATAAACTTAAAGGAAAGGGGTGG + Intergenic
1190449138 X:50560003-50560025 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1190631998 X:52397049-52397071 ACAAATTTGAGGTAAAGGGGTGG - Intergenic
1190895277 X:54612284-54612306 ACTAACATAAAGTAAAGGGGTGG - Intergenic
1190897128 X:54631627-54631649 ATAAACTTAAGGTAAAGGGTTGG - Intergenic
1190925195 X:54897148-54897170 ATAGACTGAAAGTAAAGGGATGG + Intergenic
1190955731 X:55191330-55191352 ATAAATTCAAGGTAAAAGGGTGG - Intronic
1191045515 X:56131764-56131786 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
1191065064 X:56339509-56339531 ATAAACTCAAAATAAAGGGATGG - Intergenic
1191077104 X:56466934-56466956 AGAAACTTAAGGTAAAGGGGTGG - Intergenic
1191100470 X:56721210-56721232 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1191144651 X:57153227-57153249 ATAAACTTAAGGTAAAGGCATGG - Intergenic
1191146827 X:57175429-57175451 ATGGATTCAAGGTAAAGGGGTGG - Intergenic
1191188873 X:57643545-57643567 ATAAACTAAATATAAAGGGATGG + Intergenic
1191223097 X:58012431-58012453 ATAAACTTAAGGTAAAGAAGTGG - Intergenic
1191598003 X:62969132-62969154 ATAAACTCAAAATAAAGGGATGG + Intergenic
1191787443 X:64932219-64932241 GTAAGCTTAAGGTAAAGGGGTGG - Intronic
1191804948 X:65125830-65125852 ATAAACTTAAGATAAAGGGGTGG - Intergenic
1191806854 X:65145330-65145352 ACAAACTTAAGGTAAAGGGGTGG - Intergenic
1191815404 X:65239435-65239457 ATAAACTCAAAATAAAGGGATGG - Intergenic
1191819955 X:65294629-65294651 ATAAAGTTAAGGTAAAGGGGTGG + Intergenic
1191879499 X:65830663-65830685 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1191888702 X:65918433-65918455 ATAATCTTAAGGTAAAAGCATGG - Intergenic
1191897827 X:66012433-66012455 ATAAACTCAAAGTGAAGGGTGGG + Intergenic
1191903381 X:66062539-66062561 ATAAACTTAAAATAAAGGGGTGG - Intergenic
1191906092 X:66092120-66092142 ATAAACTTATGGTAAACTAGTGG - Intergenic
1191913764 X:66179943-66179965 ATAAACTTAAAGTCAAGGGGTGG - Intronic
1191917425 X:66217815-66217837 ATAAACTTAAGGTAAAAGGGGGG + Intronic
1191945019 X:66524178-66524200 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1191954358 X:66627409-66627431 ATAACCTTAAAGAAAAGGGATGG + Intronic
1191965056 X:66749015-66749037 ATAAACCTAAAGTAAAGAGGTGG - Intergenic
1191970744 X:66813517-66813539 ATAAAATTAAGGTAAAGGGGTGG - Intergenic
1191994271 X:67074069-67074091 ATAAACTTAAAGTAAAGGGATGG + Intergenic
1192009138 X:67249689-67249711 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
1192014427 X:67314140-67314162 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1192076086 X:67998781-67998803 ACAAACTCAAAGTAAAGGGATGG - Intergenic
1192164168 X:68814848-68814870 AAAAACTTAAGGTAAAAGGGTGG + Intergenic
1192521529 X:71805290-71805312 ATAAACTGAAAATAAAGGGAAGG + Intergenic
1192673826 X:73173887-73173909 ATACACTTAAGGTAAAGGGGTGG - Intergenic
1192688456 X:73332999-73333021 ATAAACTTGAGGTAAAAGGGTGG - Intergenic
1192691054 X:73365038-73365060 ATAAATGTAAGGTAAAAGAGTGG - Intergenic
1192698092 X:73439279-73439301 ATAAACTTAAAGTAAATGGGTGG + Intergenic
1192753528 X:74020246-74020268 ATTGACTCAAGGTAAAGGGATGG + Intergenic
1192812790 X:74561782-74561804 ATAGACTGAAAATAAAGGGGTGG + Intergenic
1192820427 X:74638932-74638954 ATAAACTTAAAGTAAAGGGATGG + Intergenic
1192869242 X:75170437-75170459 ATAAACTTAAGATAAAGGGGTGG - Intergenic
1192878331 X:75255640-75255662 ATAAAATGAAGGTAAAGGGATGG + Intergenic
1192880903 X:75283136-75283158 ACAAACGTAAGGTAAAGAAGTGG - Intronic
1192900981 X:75496133-75496155 ATAAACTTAAGGTAAAGGTGTGG + Intronic
1192904154 X:75532288-75532310 ATAGACTCAAGGTAAAAGGGTGG - Intergenic
1192904760 X:75539506-75539528 ATAAACATAAGGTAAAGGGGTGG - Intergenic
1192913449 X:75630239-75630261 AAAAATTTAAAGTAAAGGGGTGG - Intergenic
1192944844 X:75955287-75955309 TAAAACTTAAGGTAAAGAAGTGG - Intergenic
1192951069 X:76016650-76016672 ATAAACTTGAGTTAAAAAGGTGG + Intergenic
1192970094 X:76219467-76219489 AAAAACTTAAAGTAAAAGGGTGG - Intergenic
1192978808 X:76316952-76316974 ATAAACTTAAAGTAAAAGGGTGG - Intergenic
1192982173 X:76356395-76356417 ATAAACTCAAGGAAAAGGATTGG + Intergenic
1192994934 X:76503612-76503634 ATAAACTTAGAGTAGAGGGGTGG - Intergenic
1193062935 X:77225309-77225331 ATATACTTAAGGTAAAGGGGTGG + Intergenic
1193077214 X:77366825-77366847 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1193154865 X:78161161-78161183 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1193185726 X:78509767-78509789 ATAAACTTAAGATAAAAGGGTGG + Intergenic
1193188644 X:78543441-78543463 ATAAACTCAAAGTAAAGGGATGG - Intergenic
1193251918 X:79301000-79301022 ATGAGCTCAAGGTAAAAGGGTGG + Intergenic
1193301086 X:79889621-79889643 ATAAATTCAAGGTAAAGAGGTGG + Intergenic
1193314866 X:80053230-80053252 ATAAACTTAAGGTAAAGAGGTGG - Intergenic
1193354572 X:80502514-80502536 ATAGACTCAAGGTAAAGGGGTGG + Intergenic
1193366503 X:80640000-80640022 ACAAACTTAAGGTAAAGTGGTGG + Intergenic
1193382822 X:80835909-80835931 ATAAACCTAAGGTAAAGGAGTGG + Intergenic
1193405082 X:81090884-81090906 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1193415509 X:81218112-81218134 ATGAACTTAAGGTAAAGGGGTGG - Intronic
1193471148 X:81906199-81906221 ACAGACTGAAGGTAAAGGGATGG - Intergenic
1193578715 X:83234653-83234675 ATAAACTTAAAGTAAAGTGATGG + Intergenic
1193590157 X:83379591-83379613 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1193590890 X:83387500-83387522 AGAAACTTAAGGTAAAGGGGTGG + Intergenic
1193594158 X:83424997-83425019 ATAAAATTAAGGTAGAAGTGAGG + Intergenic
1193618871 X:83725961-83725983 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1193635634 X:83946108-83946130 ATAGGCTTAAAGTAAAGGAGTGG - Intergenic
1193649470 X:84111961-84111983 ACAGACTTAAAGTAAAGGGGTGG + Intronic
1193664825 X:84302760-84302782 ATAGACTGAAAGTAAAGGGACGG + Intergenic
1193690606 X:84636777-84636799 ATAAACTTAAAGTAAAGGGATGG + Intergenic
1193721780 X:84995421-84995443 ATAGACTGAAGGTAAAAGGGTGG + Intergenic
1193736571 X:85164114-85164136 ATAAATTTAAGGTAAGGGAATGG - Intergenic
1193775764 X:85640124-85640146 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1193791831 X:85823673-85823695 ACAAACTTAAGGTAAAGGGGTGG + Intergenic
1193793404 X:85843875-85843897 ATACACTGAAAGTAAAGGGATGG + Intergenic
1193817362 X:86120283-86120305 ATAAACTTAAGGTGAAGGGATGG - Intergenic
1193891719 X:87054678-87054700 ATAAAATTAAGCTAAAGCAGTGG + Intergenic
1193924636 X:87468384-87468406 ATAAACTTAATGTAAAGGGGTGG + Intergenic
1193937339 X:87638973-87638995 ATAAACTTAAGGTAAAGGAGTGG + Intronic
1194058589 X:89167614-89167636 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1194106942 X:89781124-89781146 ATAGACTGAAAGTAAAGGGATGG + Intergenic
1194144526 X:90246225-90246247 ATAAACTCAAGGTAAAGGGGTGG + Intergenic
1194165536 X:90509938-90509960 ATAAACTTAAGGTAAAGGAGTGG + Intergenic
1194168279 X:90549787-90549809 ATTAACTTAAGGTAAAGGGGTGG + Intergenic
1194183935 X:90748249-90748271 ATAAACTTAACATAAAGGGGTGG - Intergenic
1194205549 X:91007115-91007137 AGAAACATAAGGTAAAATGGTGG - Intergenic
1194214141 X:91108054-91108076 ATAAATGTAAGGTGAAGAGGAGG - Intergenic
1194224723 X:91242727-91242749 ATAAACTTAAGGTAAAGAGGTGG - Intergenic
1194228954 X:91298417-91298439 ATAAGCTTAAAATAAAGGGATGG - Intergenic
1194237393 X:91401059-91401081 TTAAACTTAAGGTAAACGGATGG + Intergenic
1194260424 X:91687595-91687617 ATAGACTCAAAGTAAAGGGTTGG + Intergenic
1194262883 X:91718663-91718685 ATAAACTTAAGGTAATGGGGTGG + Intergenic
1194278404 X:91915468-91915490 ATAAACTTAAGGTAATGGGGTGG + Intronic
1194335533 X:92641808-92641830 ATATACTCAAGGCAAAGGGGTGG - Intergenic
1194354053 X:92858475-92858497 ATGAACTTAAAGTAAAGGGGTGG + Intergenic
1194384923 X:93240115-93240137 ATAAACTCAAAGTAAAGTTGTGG + Intergenic
1194425862 X:93737641-93737663 ATAGACTTAAGGTAAAGAGAAGG - Intergenic
1194466336 X:94238528-94238550 ATAAACTTAAAGTAAAGGAATGG + Intergenic
1194468366 X:94260014-94260036 CATAGCTTAAGGTAAAGGGGTGG + Intergenic
1194516129 X:94856363-94856385 ATAAACTTAAGTTCAAATGGTGG + Intergenic
1194532993 X:95073862-95073884 ATAAACTTAAGGTAAAGGAGTGG + Intergenic
1194543268 X:95201653-95201675 ATAAACTTAAAATAAAAGGGTGG - Intergenic
1194547476 X:95255861-95255883 ATAAACTTAAGATAAAGGGGTGG - Intergenic
1194553970 X:95334870-95334892 AAAAACTTAAAGTAAATGGGTGG + Intergenic
1194557075 X:95372814-95372836 ATAAACTCAAGGTAAATGGGTGG + Intergenic
1194630467 X:96276427-96276449 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
1194778731 X:97996973-97996995 CTAAACTTAAAGTCAAGGGTTGG - Intergenic
1194872458 X:99149175-99149197 ATAGACTCAAAGTAAAGGGATGG + Intergenic
1194881643 X:99259601-99259623 ACAAATTTAAGGTAAAGGTGTGG - Intergenic
1194934783 X:99935983-99936005 ATAAACTTAAGGTAAAGGAGTGG - Intergenic
1195019311 X:100810873-100810895 ATAAACTTAAAATAAAGGGGTGG - Intergenic
1195076263 X:101329765-101329787 ATAAACTTAAGGTAAACAGGTGG + Intergenic
1195153660 X:102099529-102099551 ATAAACTCAAAATAAAGGGAAGG + Intergenic
1195155390 X:102117706-102117728 ATAGACTCAAAGTAAGGGGGTGG + Intergenic
1195512271 X:105730145-105730167 ATAGACTAAAAGTAAAGGGATGG + Intronic
1195735000 X:108003074-108003096 ATAGGCTCAAGGTAAAGGGTTGG + Intergenic
1195786501 X:108529685-108529707 ATAGACTGAAAGTAAAGGGATGG + Intronic
1195801532 X:108717240-108717262 ATAACCTTAATATAAAGAGGGGG + Intergenic
1195818234 X:108911820-108911842 ATAAACTTACGGTAAAAGGGTGG + Intergenic
1195834210 X:109094497-109094519 ATAGACTCAAAGTAAAGGGATGG - Intergenic
1195855430 X:109326870-109326892 ATAAACTTAAGGTTAAAGGATGG + Intergenic
1195984971 X:110619901-110619923 AAAAACTTAAGGTAAAGGGGTGG - Intergenic
1196171093 X:112589345-112589367 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1196219094 X:113090194-113090216 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1196477872 X:116110171-116110193 ACAAACTTAAGGTAAAGGGATGG - Intergenic
1196508988 X:116482629-116482651 ATACACTTAAAATAAAGGGATGG + Intergenic
1196519198 X:116653134-116653156 ATAAACTTAAGGTAGAAGAGTGG - Intergenic
1196538715 X:116880094-116880116 ATAGACTTAAAATAAAGGGATGG - Intergenic
1196590300 X:117479689-117479711 ATAAACTTAAAGTAAAGGGATGG - Intergenic
1196948017 X:120848135-120848157 ACAAACTTAAGGTACAGGGGTGG - Intergenic
1196994494 X:121366792-121366814 ATAAGCTTAAGGTAAAGGGGTGG - Intergenic
1197027904 X:121777581-121777603 GTAGACTGAAGGTAAAGGGGTGG - Intergenic
1197054454 X:122099560-122099582 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1197066034 X:122235453-122235475 ATAAACTTAAAGTAAATGGGGGG - Intergenic
1197081555 X:122424601-122424623 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1197110324 X:122765406-122765428 ATAAACTGAAGGTAACAGGATGG + Intergenic
1197132648 X:123022270-123022292 ATAAACTTAAAGTAAAGGGGTGG + Intergenic
1197184578 X:123572277-123572299 ATAAACTTACAATAAAGGAGTGG + Intergenic
1197186682 X:123595236-123595258 ATAAACTGATGGTGAAGGGGGGG - Intergenic
1197363771 X:125538291-125538313 ATAAACTAAAGGTAAAGGGATGG + Intergenic
1197393111 X:125893462-125893484 ATAAACTTAAAATAAAGGGGTGG - Intergenic
1197463603 X:126773470-126773492 ATAAACTTAAGGTAATGGGGTGG + Intergenic
1197471994 X:126875553-126875575 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1197476117 X:126927785-126927807 ATTAACTTAAGGTAAATGTGTGG - Intergenic
1197504108 X:127280196-127280218 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1197515349 X:127421264-127421286 ATAAGCTTAAGGTAAAGGGGTGG - Intergenic
1197522926 X:127521797-127521819 ATAGACTCAAAATAAAGGGGTGG + Intergenic
1197545460 X:127818162-127818184 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1197552425 X:127909289-127909311 ATAAACTCAAGTTAAAGAGGTGG + Intergenic
1197574265 X:128189852-128189874 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1197664413 X:129208569-129208591 ATAAACTTAAGGTGAAGGGGTGG - Intergenic
1197668883 X:129254070-129254092 ATAAATTTAAAGTAAAGGGATGG - Intergenic
1197671390 X:129282225-129282247 ATAAACTTCAAGTAAAGGTGTGG - Intergenic
1197729881 X:129800583-129800605 ATAAACATAAGGCAGAGGAGAGG + Intergenic
1197953890 X:131925675-131925697 ATAAACTTAAAATAAAGGAGTGG + Intergenic
1198168949 X:134085670-134085692 ATAAGCTCAAAGTAAAGGGATGG + Intergenic
1198448659 X:136744045-136744067 ATAATCTTTAGATAATGGGGAGG - Intronic
1198559678 X:137836079-137836101 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1198583088 X:138088541-138088563 ATAAACTTAAGGTAAATGGGTGG + Intergenic
1198604299 X:138320295-138320317 ATAAACTTAAAGTAAAGGGATGG - Intergenic
1198609822 X:138385279-138385301 AAAAACTCAAAGTAAAAGGGTGG + Intergenic
1198616645 X:138465134-138465156 ATAAACTTAAGGTAAAGGGGTGG + Intergenic
1198649818 X:138850078-138850100 ATAAGCTCAAGGGAGAGGGGAGG + Intronic
1198664938 X:139009934-139009956 ATAAACTTAAGGTAAAGGAGTGG + Intronic
1198696978 X:139352363-139352385 ATAGACTGAAAATAAAGGGGTGG - Intergenic
1198797080 X:140408772-140408794 ATAAACTTAAGGTAAAGGGGTGG - Intergenic
1199057637 X:143317234-143317256 ATAAACTTAAAGTAAAGGGGTGG - Intergenic
1199077407 X:143539907-143539929 ATAAACTCAAGGTAAAGGGGTGG + Intergenic
1199103471 X:143835018-143835040 ATAAACATAAGCTAAAGAGGTGG + Intergenic
1199173111 X:144755192-144755214 ATAGACTTAAAATAAAGGGATGG - Intergenic
1199180723 X:144850857-144850879 ATAGACTGAAAGTAAAGAGGTGG + Intergenic
1199298301 X:146184068-146184090 ATAAATTTAAGGTAAAGGACTGG - Intergenic
1199323124 X:146464146-146464168 ATAAACTCAAGGTAAAGGGGTGG - Intergenic
1199555883 X:149108202-149108224 CTAGACTTTAGTTAAAGGGGAGG + Intergenic
1199563822 X:149193177-149193199 ATAGACTCAAAGTAAAGGGATGG + Intergenic
1199587058 X:149425713-149425735 ATAAACTTAAGGTATAGAGGTGG + Intergenic
1199668748 X:150123089-150123111 ATAAACTTAAAGTACAGAGGTGG + Intergenic
1199755222 X:150857970-150857992 ATAGACTGAAAGTAAAGGGGTGG + Intronic
1199821542 X:151454057-151454079 ATAAACCTAAAGTAAAGGGGTGG + Intergenic
1199926524 X:152472151-152472173 AAAAACTTAAAGTAAAGGGGTGG + Intergenic
1200317905 X:155153686-155153708 ATCAACTTAAGGTAAAGGGGTGG - Intergenic
1200458905 Y:3428983-3429005 ATAGACTGAAAGTAAAGGGATGG + Intergenic
1200490282 Y:3815530-3815552 ATAAACTCAAGATAAAGGGGTGG + Intergenic
1200511803 Y:4087747-4087769 ATAAACTTAAGGTAAAGGAGTGG + Intergenic
1200514525 Y:4127567-4127589 ATTAACTTAAGGTAAAGGGGTGG + Intergenic
1200530527 Y:4330180-4330202 ATAAATTTAACATAAAGGGGTGG - Intergenic
1200551305 Y:4581940-4581962 AGAAACATAAGGTAAAATGGTGG - Intergenic
1200561187 Y:4706037-4706059 ATAAACTTAAGGTAAAGCGGTGG - Intergenic
1200595739 Y:5137548-5137570 ATAAACTTAAGGTAATGGGGTGG + Intronic
1200643962 Y:5758566-5758588 ATATACTCAAGGCAAAGGGGTGG - Intergenic
1200662407 Y:5975494-5975516 ATGAACTTAAAGTAAAGGAGTGG + Intergenic
1200738329 Y:6825862-6825884 ATAAACTTAAGGTAATGTGAGGG - Intergenic
1200956022 Y:8946912-8946934 ATAGACTCAAAGTAAAGGGATGG - Intergenic
1201307822 Y:12565917-12565939 ATAAACTTAAAGTAAAGAGGTGG - Intergenic
1201394876 Y:13537416-13537438 ATACACTAAAGGTAAAGGAATGG + Intergenic
1201408750 Y:13676106-13676128 AAAAACTTAAGGTAAATGGGTGG + Intergenic
1201544404 Y:15144928-15144950 AAAAACTTAAGGAAAAATGGAGG + Intergenic
1202036226 Y:20639435-20639457 ATAAACTTAAGGTTAATGGGTGG - Intergenic
1202039500 Y:20667387-20667409 ATTAACAGAAGGTAAAAGGGTGG - Intergenic
1202297426 Y:23374911-23374933 ATAGACTAAAAGTAAAGGGAGGG - Intergenic
1202573383 Y:26295686-26295708 ATAGACTAAAAGTAAAGGGAGGG + Intergenic