ID: 1171378454

View in Genome Browser
Species Human (GRCh38)
Location 20:24713017-24713039
Sequence CTCATAAACTTAAGGTAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1466
Summary {0: 7, 1: 277, 2: 436, 3: 355, 4: 391}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171378454_1171378461 21 Left 1171378454 20:24713017-24713039 CCCCTTTACCTTAAGTTTATGAG 0: 7
1: 277
2: 436
3: 355
4: 391
Right 1171378461 20:24713061-24713083 TCTTAAAGGCAGCAGATACTTGG No data
1171378454_1171378460 7 Left 1171378454 20:24713017-24713039 CCCCTTTACCTTAAGTTTATGAG 0: 7
1: 277
2: 436
3: 355
4: 391
Right 1171378460 20:24713047-24713069 ATGTTAGGCGAGTCTCTTAAAGG No data
1171378454_1171378458 -8 Left 1171378454 20:24713017-24713039 CCCCTTTACCTTAAGTTTATGAG 0: 7
1: 277
2: 436
3: 355
4: 391
Right 1171378458 20:24713032-24713054 TTTATGAGACCTTATATGTTAGG No data
1171378454_1171378462 25 Left 1171378454 20:24713017-24713039 CCCCTTTACCTTAAGTTTATGAG 0: 7
1: 277
2: 436
3: 355
4: 391
Right 1171378462 20:24713065-24713087 AAAGGCAGCAGATACTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171378454 Original CRISPR CTCATAAACTTAAGGTAAAG GGG (reversed) Intergenic
900030106 1:365029-365051 CACAAAAACTTAATGGAAAGAGG - Intergenic
900050758 1:594093-594115 CACAAAAACTTAATGGAAAGAGG - Intergenic
901356759 1:8656780-8656802 CTCATAATATTAATTTAAAGAGG + Intronic
902969381 1:20035583-20035605 CACTTAAACTTAAGGTATAGGGG - Intronic
903752376 1:25633642-25633664 CATATAAACTCAAAGTAAAGGGG - Intronic
904572299 1:31475683-31475705 CACATAAACTTAAGTTAAAGGGG - Intergenic
905638666 1:39573924-39573946 ATCATAGCCTTAAGGAAAAGTGG - Intronic
906053771 1:42898139-42898161 CATATAAACTTAAAGTAAAAGGG - Intergenic
906563809 1:46781798-46781820 CACATAAACTTAAAGTAAATGGG - Intronic
906910711 1:49945836-49945858 TACATAAACTGAAAGTAAAGAGG + Intronic
907001423 1:50862670-50862692 CACACAAACTTAAGGTAAAGGGG + Intronic
907349355 1:53813405-53813427 CACATAAACTTAAAGTAAAAGGG + Intronic
907539067 1:55195749-55195771 CTCAGAAACAGAAAGTAAAGTGG + Intronic
908174906 1:61545856-61545878 TACATAAACTTAAAGTAAAGGGG - Intergenic
908558986 1:65285966-65285988 CTCAAAAACCTAAAATAAAGTGG - Intronic
908803440 1:67904996-67905018 CACATAAGCTTAAGGTAAAGGGG - Intergenic
908862129 1:68500897-68500919 CACATAAACTTAAGGTAAAGGGG + Intergenic
908883626 1:68761384-68761406 CACATAAACTTAAGGTAAAGGGG + Intergenic
908890595 1:68843357-68843379 CACATAAACTTAAGGTAAAGGGG - Intergenic
909235057 1:73142504-73142526 CACATAAACTTAAGGTAAAGGGG - Intergenic
909405667 1:75286335-75286357 CACATGAACTTAAGGTAAAGGGG - Intronic
909511159 1:76454144-76454166 CTTCTAAACTTAAGGTAAAGGGG - Intronic
909673838 1:78216831-78216853 CACATAAACTTAAAGTAATGGGG + Intergenic
909712755 1:78671735-78671757 CTTACAGACTCAAGGTAAAGGGG - Intergenic
909790953 1:79677993-79678015 CACATAAACTTAAGATAAAGCGG - Intergenic
909828157 1:80152329-80152351 CACATAAATTTAAGGTAAAGGGG - Intergenic
909860271 1:80595969-80595991 CACGTAAACTTAAGGTAAAGGGG + Intergenic
909981189 1:82103424-82103446 CACATAAACTTAAAGTAAATGGG - Intergenic
910077805 1:83300830-83300852 CACATAAACTTCAAGTAAAGGGG + Intergenic
910232918 1:85005023-85005045 CACATAAACTTAAGGTAAAGGGG + Intronic
910323673 1:85978497-85978519 CAAATAAACCTAAGGTAAAAGGG + Intronic
910598240 1:89003214-89003236 CACATAAAGTTAAAGTAAATGGG - Intergenic
911080913 1:93929502-93929524 CACATAAACTTAAAGTTAAGGGG + Intergenic
911265691 1:95740965-95740987 CATATAAACTTAAGGTACAGTGG - Intergenic
911678709 1:100689907-100689929 CACATAAACTTAAAGTAGAAAGG - Intergenic
911743462 1:101412874-101412896 CACATAAAATTAAGGCAAAGGGG + Intergenic
911805995 1:102209282-102209304 TACCTAAACTTAAGGTAAAGAGG - Intergenic
911940916 1:104046536-104046558 CTCATAGGCTCAAGGTAATGTGG - Intergenic
912082141 1:105950013-105950035 CACATAAACTTAAGGCAAAGGGG - Intergenic
913035616 1:114962524-114962546 CACATAAACTTAAGGTAAAGGGG - Intronic
913151557 1:116048877-116048899 CACATAAACTTAAGGTAAAGGGG + Intronic
913236378 1:116787182-116787204 CACATAAACTTAAGGTAAAGGGG + Intergenic
913337302 1:117720545-117720567 CACATAAACTTAAGGTAAAGGGG + Intergenic
913339542 1:117745200-117745222 CACATGAACTTAAGGTAAAGTGG - Intergenic
913383600 1:118235458-118235480 CACATGAAGTTAAGGTAAAGGGG + Intergenic
913493713 1:119407008-119407030 CATATAAACTTAGGGTAAAGGGG + Intergenic
913588006 1:120295263-120295285 CACATAAACTTAAGGTAAAGGGG - Intergenic
913620179 1:120603106-120603128 CACATAAACTTAAGGTAAAGGGG + Intergenic
914455286 1:147831035-147831057 CACATAAACTTAAAGCAAAGGGG - Intergenic
914570022 1:148907136-148907158 CACATAAACTTAAGGTAAAGGGG - Intronic
914602807 1:149223133-149223155 CACATAAACTTAAGGTAAAGGGG + Intergenic
914968166 1:152279823-152279845 CACATGAACCTAAAGTAAAGGGG + Intergenic
915800898 1:158792258-158792280 CTTATAGGCTCAAGGTAAAGGGG - Intergenic
915821444 1:159028833-159028855 CATATAAACATAAGGTAAAGGGG - Intronic
915999743 1:160604062-160604084 AACATAAACTTAAGGTAAAGGGG - Intergenic
916331503 1:163623006-163623028 CATATAAACCTAAGGTAAAGGGG - Intergenic
916868922 1:168890735-168890757 CATATAAACTCAAGGTAAAAGGG + Intergenic
916872972 1:168937692-168937714 CACAAAAACCTAAGGTAAAGGGG - Intergenic
917351399 1:174081894-174081916 CACATAAACTTAAGGTAAAGGGG + Intergenic
917425425 1:174907944-174907966 CACATAGACTTAATGTGAAGGGG + Intronic
917461781 1:175236721-175236743 CACATAAACTTAAAGTATAGGGG + Intergenic
917573078 1:176290407-176290429 CATATAAACTCAAGTTAAAGGGG + Intergenic
918103905 1:181400359-181400381 CACATAAACTTCAGGAAAGGAGG - Intergenic
918450988 1:184658287-184658309 CCCATAAAATGAAGGTGAAGTGG - Intergenic
918718462 1:187822258-187822280 CGCATACACTTAAGATAAAGGGG - Intergenic
919115316 1:193274326-193274348 CACATAAACTTAAAGTAAAGGGG - Intergenic
919214288 1:194532692-194532714 CACATAAACTTAAGGTAAAGGGG - Intergenic
919281329 1:195493606-195493628 CACATAAACTTAAGGTTATAGGG - Intergenic
919298812 1:195735027-195735049 CTGATAGACTTGAGGTTAAGGGG + Intergenic
919320472 1:196030548-196030570 CTGAAAAACTTAAGAGAAAGTGG + Intergenic
919397781 1:197071889-197071911 CACATAAACTTAAGGTAAAGGGG + Intergenic
919485484 1:198141439-198141461 CACATAAACTTAAGGTAAGGGGG - Intergenic
919520316 1:198580524-198580546 CACATGAACTTAAAGTAAAGGGG - Intergenic
919571721 1:199257226-199257248 CACATAAACTTAAGGTAAAGGGG - Intergenic
919598634 1:199595206-199595228 CACGTAAACTGAAAGTAAAGTGG + Intergenic
920726768 1:208443594-208443616 CACATAAACTTAAAGTAAAGGGG - Intergenic
920990019 1:210927836-210927858 CACATAAACTTAAGGTAAAGGGG + Intronic
921196632 1:212763560-212763582 CATAAAAATTTAAGGTAAAGGGG + Intronic
921532696 1:216305375-216305397 CACATAAACTTAAGGTAAAGAGG - Intronic
921762700 1:218935449-218935471 CACATAAACTTAAGGTAAAGGGG - Intergenic
921843089 1:219849109-219849131 CACACAAACTTAAGATAAAGGGG + Intronic
922377496 1:224983314-224983336 AACATAAACTTAAAGTAAAGGGG - Intronic
922395810 1:225200196-225200218 CACATAAACTTAAGATAAAGGGG - Intronic
922927163 1:229359278-229359300 CACATAAACTTAAAGTAAAGGGG - Intergenic
923122453 1:231004761-231004783 CTCATAAACTTAAGGCAAAGGGG + Intergenic
923458940 1:234190345-234190367 CACATAAACTTAAGGTAAAGGGG + Intronic
923691739 1:236200706-236200728 CACATAAACTTAAGGTAAAGGGG - Intronic
923808444 1:237286669-237286691 CACATAAACTTAAAGTAAAGGGG - Intronic
923874903 1:238036561-238036583 CACATAAACTTAAAGCAAAGGGG + Intergenic
923909951 1:238430588-238430610 CACATAAATTTAAAGTAGAGGGG - Intergenic
923960925 1:239083003-239083025 CACATAAACTTAAGGTAAATGGG - Intergenic
924193050 1:241576125-241576147 CACACAAACTCAAGGTAGAGGGG - Intronic
924691737 1:246358091-246358113 CACATAAACTTAAGGTAAAGGGG + Intronic
924767806 1:247050392-247050414 CACATAAACCTAAGGTAAAGAGG - Intronic
924877973 1:248126906-248126928 TACATAAACTTAATATAAAGGGG - Intergenic
924883097 1:248185046-248185068 CACATAAACTTAAGATAAAGGGG - Intergenic
924885193 1:248208175-248208197 CACATAAACTTAAGTTAAAGGGG - Intergenic
924894347 1:248319193-248319215 CACATAAACTTACTATAAAGGGG + Intergenic
924930089 1:248722950-248722972 CACATAAACTTAAGGTAAAGCGG + Intronic
1063561101 10:7128688-7128710 CACATAAACTTATGGTAAAGGGG - Intergenic
1064552422 10:16517848-16517870 ATCATAAACAAAAGGTTAAGTGG + Intronic
1064557022 10:16557582-16557604 CACATAAACTTAAGGTAAATGGG - Intergenic
1065158080 10:22891573-22891595 CCTATAGACTCAAGGTAAAGGGG - Intergenic
1065355482 10:24836088-24836110 CATATAAACTTAAGATAAAGGGG + Intergenic
1065462583 10:25984389-25984411 CGCAAAAACTTAAGGTAAAGGGG + Intronic
1065470755 10:26079362-26079384 CACATAAACTTAAAGTAAAGGGG - Intronic
1065894384 10:30150221-30150243 CACATAAACTTAAGGTAGGGGGG - Intergenic
1066145333 10:32552263-32552285 CGCATAAACTTAAAGTAAATGGG - Intronic
1066651075 10:37655708-37655730 CACATAAACTTAAGGTAAAGGGG + Intergenic
1067234016 10:44432919-44432941 CACATAAACTTAAGGTAAAGGGG - Intergenic
1067420980 10:46147472-46147494 CTTATAAAATTAAAATAAAGTGG - Intergenic
1067490806 10:46700093-46700115 CTTATAAAATTAAAATAAAGTGG - Intergenic
1067506319 10:46853938-46853960 CTTATAAAATTAAAATAAAGTGG - Intergenic
1067562446 10:47313543-47313565 CTAATAAATTAAAGGTACAGTGG + Exonic
1067603857 10:47640274-47640296 CTTATAAAATTAAAATAAAGTGG + Intergenic
1068122653 10:52799523-52799545 CACATAAACTGAAGGTGAAGGGG - Intergenic
1068157220 10:53215783-53215805 CACTTAAACTTAAGGTGAAGGGG - Intergenic
1068172927 10:53419847-53419869 CACATAAACTTAAGGTGAGAGGG - Intergenic
1068368177 10:56078795-56078817 ATTATAGACTCAAGGTAAAGGGG + Intergenic
1068383467 10:56291646-56291668 CACATAGACTGAAAGTAAAGGGG - Intergenic
1068808706 10:61229991-61230013 CAGATAAACTTAAGTTAAAGGGG + Intergenic
1068924829 10:62525223-62525245 CACATAAACTTAAGGTAAAGGGG - Intronic
1069088590 10:64171805-64171827 CTCATAGTCTGAAGGCAAAGAGG + Intergenic
1069113085 10:64470417-64470439 TACAGAAACTTAAGGTAATGGGG + Intergenic
1069146184 10:64894621-64894643 CACATAAACTTAAGATAAAGGGG - Intergenic
1069150310 10:64952107-64952129 CACATGAACTTAAAGTAAAGGGG - Intergenic
1069199917 10:65600514-65600536 CACATAAACTTAAGGGAAAGAGG - Intergenic
1071015683 10:80994943-80994965 CATATAAACTTAAGGTAAAGGGG - Intergenic
1071023994 10:81091063-81091085 CACATAAACTTAAGGTAAAGGGG - Intergenic
1071045778 10:81374690-81374712 CACAAAAACTTAAGCTAAAGGGG - Intergenic
1072164054 10:92794919-92794941 CACATAAACTTAAAGTAAAGGGG + Intergenic
1072331300 10:94355309-94355331 CTCATAAACCAAAGGAAAATAGG + Intronic
1072331303 10:94355339-94355361 CTCATAAACCAAAGGAAAATAGG + Intronic
1072638136 10:97190462-97190484 CTCCTAGACTAAAGGTCAAGTGG + Intronic
1072928222 10:99635746-99635768 CACATAAACTTAAAGTAAAGGGG + Intergenic
1073900276 10:108213280-108213302 CTCACAAACTTGAGGTAAAAGGG - Intergenic
1074466650 10:113689270-113689292 CTTATAGAATCAAGGTAAAGGGG - Intronic
1074597162 10:114878159-114878181 CTTATAATGTTAAGGTAAAAAGG - Intronic
1074635533 10:115311970-115311992 CTTATAGACTCAAGGTAAAGGGG - Intronic
1075157947 10:119995595-119995617 CACATAAATTTAAGGTAAATGGG - Intergenic
1075660416 10:124191427-124191449 CACATAAACTTAAAGTAAAGGGG - Intergenic
1075947003 10:126442181-126442203 CACATAAACTTAAACTAAAGAGG + Intronic
1076112183 10:127869035-127869057 CATATAGACTCAAGGTAAAGGGG - Intergenic
1076376118 10:129986568-129986590 CACATAAACTTCAGGTAAAGGGG + Intergenic
1076665398 10:132086723-132086745 CACATAAACTTAAGGTAAAGGGG - Intergenic
1077774993 11:5260654-5260676 CACATAAACTTAAGGTAAAGGGG + Intronic
1078127721 11:8584799-8584821 GTCATAACCCTAAGGTAAACAGG + Intronic
1078288795 11:9985230-9985252 CACATAAACTTAAGGTAAAGGGG + Intronic
1078687147 11:13544177-13544199 CACAAAAACTTAAGGTCAAGAGG + Intergenic
1078991389 11:16649910-16649932 CACATAACCGAAAGGTAAAGGGG + Intronic
1079273463 11:19011418-19011440 CACATAAACTTAAAGTAAAAGGG - Intergenic
1079463986 11:20711246-20711268 CACACTAACTAAAGGTAAAGGGG - Intronic
1079791483 11:24745571-24745593 CATATAAACTTAAAGTAAAGTGG - Intronic
1079805835 11:24930094-24930116 CAAATAAACTTAAGGTAAGGGGG - Intronic
1079951972 11:26817366-26817388 CACATAAAATTAAGGGAAAGGGG - Intergenic
1079956300 11:26869624-26869646 CATACAAACTTAAGATAAAGGGG + Intergenic
1080203152 11:29697638-29697660 CACATAGACTTAAGGTAAAGGGG - Intergenic
1080324317 11:31052127-31052149 CACATAAACATAAAGTAAAGGGG + Intronic
1080402496 11:31949147-31949169 CACATAAACTTATAGTAAATGGG + Intronic
1080672345 11:34392918-34392940 CACATAAACTTAAAGTAAAGGGG - Intergenic
1080863886 11:36176161-36176183 CACATAAACTTAAGGTAAAGGGG - Intronic
1081009567 11:37792223-37792245 CAGACAAACTTAAGGTAAAGGGG - Intergenic
1081064692 11:38526063-38526085 CGTATAAACTCAAGGTAAAAGGG + Intergenic
1081195448 11:40154489-40154511 CAAATAAACTTAAAGTAAAGGGG + Intronic
1082104179 11:48202030-48202052 CACATAAACTTAAGGTAAAGGGG + Intergenic
1082111660 11:48283394-48283416 CACATAAACTTAAGATGAACAGG - Intergenic
1082120680 11:48376617-48376639 CACATAAACCTGAGGTAAATGGG - Intergenic
1082679987 11:56155379-56155401 CACATAAACATAAGGTAAAGGGG + Intergenic
1082917054 11:58448422-58448444 CACATAAACTTAAAGTAAAGGGG + Intergenic
1083005592 11:59342745-59342767 CACATAATCTTAAGGGAAAATGG - Intergenic
1083064381 11:59909203-59909225 TGCAAAAACTTAAAGTAAAGGGG - Intergenic
1083127033 11:60580128-60580150 CACATAAACTTAAAGGAAAGGGG + Intergenic
1083188402 11:61031886-61031908 CTCACACACTTAAGGAACAGGGG + Intergenic
1085240333 11:75048309-75048331 CACATAAACTTAAGGTAAAGGGG - Intergenic
1085748063 11:79131813-79131835 CACATAAATTTAAAGTAAAGGGG + Intronic
1085917360 11:80905286-80905308 CACACAAACTTAAGGTAAAGGGG + Intergenic
1086306865 11:85489198-85489220 CACATAGACTAAAAGTAAAGAGG + Intronic
1086813452 11:91338714-91338736 CATATAAACTCAAGGTACAGGGG + Intergenic
1086997704 11:93377479-93377501 CACACAAACTTAAGGTAAAGGGG - Intronic
1087395486 11:97591304-97591326 CACATAAATTTAAGGTAAAGGGG + Intergenic
1087405482 11:97724350-97724372 CACATAAACTTAAAGTAAAAAGG + Intergenic
1087469061 11:98547808-98547830 CACATAAACTTAAGGGAAAGAGG + Intergenic
1087602255 11:100331108-100331130 CATATAAACTTAAGGTAAAAAGG + Intronic
1087676073 11:101163512-101163534 CTTATAGACTGAAAGTAAAGGGG - Intergenic
1087688746 11:101295684-101295706 CACATAAACTTAAGGTAAAGGGG - Intergenic
1087743983 11:101921752-101921774 ATCATGAACTTCAGATAAAGAGG - Intronic
1087804516 11:102541132-102541154 CACATAAACTTAAATTAAAGGGG + Intergenic
1087866012 11:103228048-103228070 CTCATAAACTTAAGGTAAAGGGG - Intronic
1088137512 11:106576156-106576178 CACATAAACTTAAAGTAAAGGGG - Intergenic
1088179660 11:107094574-107094596 CATATAAACTTAAGGTAAAGGGG + Intergenic
1088372265 11:109104747-109104769 CACAGAAACTTAAGGTAAAGGGG - Intergenic
1088387858 11:109279821-109279843 CAAATAAACTTAAAGTAAAGGGG - Intergenic
1088413599 11:109565212-109565234 CACATAAACTTAAGGTAAAATGG - Intergenic
1088552648 11:111029009-111029031 CTTATAAACTCAAGGTAAAGGGG + Intergenic
1088580731 11:111313336-111313358 CACATAAACTTAAGGAAAAGGGG + Intergenic
1088800275 11:113299255-113299277 CCCATAAACTTTAGGTAAAGGGG + Intergenic
1088951347 11:114573492-114573514 CACATAAACTTAAGGTAAAGGGG + Intronic
1089107583 11:116025919-116025941 CACATAAACTTAAAGTAAAGGGG + Intergenic
1089826056 11:121278951-121278973 CAGGTAAACTTAAAGTAAAGGGG - Intergenic
1089837151 11:121380996-121381018 CACATAAATTTAGGGTAAAGAGG + Intergenic
1089952699 11:122544831-122544853 CACATAAACTTAAAGTAAAGGGG - Intergenic
1090545443 11:127761338-127761360 CACATAAACTTAAGGTAAAGGGG + Intergenic
1090682874 11:129079878-129079900 CACATAAACTTAAGGTAAAGGGG + Intronic
1090688426 11:129151003-129151025 CAACAAAACTTAAGGTAAAGGGG + Intronic
1090892401 11:130936175-130936197 CTCTTAAACTCTATGTAAAGTGG - Intergenic
1090894812 11:130962570-130962592 CACATAAACTTACAATAAAGGGG - Intergenic
1091380982 12:59195-59217 CACATAAACTTAAGGTAAAGGGG + Intergenic
1092060249 12:5544755-5544777 CACATAGACTTAAGGTAAAAGGG + Intronic
1092602862 12:10085422-10085444 CACATAAACTTAAGGTAAAGAGG + Intronic
1092604654 12:10105066-10105088 CATATAAATTCAAGGTAAAGGGG + Intronic
1092700179 12:11219846-11219868 CACATAAACTTAAGGTAAAGAGG + Intergenic
1093001835 12:14005960-14005982 CACATAAACTTAAGGTGAAGGGG - Intergenic
1093010726 12:14103789-14103811 CACATAAACTTAAAGTAAAGGGG + Intergenic
1093277753 12:17150608-17150630 CACATAAACTTAAGGTTTAGGGG + Intergenic
1093409017 12:18843103-18843125 CACATAAATTTAAAGTAAAGGGG - Intergenic
1093468855 12:19479841-19479863 CAAATAAACTTAAGGTAAAGGGG - Intronic
1093598139 12:20986668-20986690 CACATAAACTTAAAGCTAAGGGG - Intergenic
1093608392 12:21123173-21123195 CACATAAACTTAAGGTAAAAGGG + Intronic
1093720773 12:22439235-22439257 CACATAAACTTAAAATAAAGGGG + Intergenic
1093901094 12:24633919-24633941 CTCATACAGTATAGGTAAAGTGG + Intergenic
1093948566 12:25137668-25137690 CACATAAACTTAAAGTAAAGAGG + Intronic
1093963954 12:25305309-25305331 CATATAAACTTAAGGTAAAGGGG + Intergenic
1093991627 12:25594857-25594879 CACATAAACTCAAGGTAAAAAGG + Intronic
1093995162 12:25632946-25632968 CACATAAACTTAAAGTAAAAGGG + Intronic
1094447163 12:30544366-30544388 CACATAAACTTAAAGTCAAGGGG - Intergenic
1094721826 12:33073542-33073564 CACATAAACTTCAGATAAAGTGG - Intergenic
1094789413 12:33894324-33894346 GTTATAAACTTAAGGTAAAGGGG + Intergenic
1095118048 12:38379988-38380010 CACATAAACTTAAAGCAAAAGGG - Intergenic
1095121037 12:38419399-38419421 CACATAAACTTAAGCTAAAGTGG + Intergenic
1095225997 12:39677219-39677241 CACATAAACTTAAGGGGAAGAGG + Intronic
1095500849 12:42837274-42837296 CACATAAACTTAAGGTAAGGGGG - Intergenic
1095557590 12:43525649-43525671 CATATAAACTCAAGGTAAAGAGG + Intronic
1095777015 12:46021288-46021310 CTTACAAACTCAAGGTAAAGGGG - Intergenic
1095893012 12:47252215-47252237 CACATAAACTTAAAGTAAAGGGG + Intergenic
1096437872 12:51610249-51610271 CACATAAACTTCAGGTAAACAGG - Intronic
1096897387 12:54837451-54837473 CTTATAGACTTGAGGTAAAGGGG - Intronic
1096956643 12:55532914-55532936 CACATAAACTGAAGGTAAAGGGG + Intergenic
1096957034 12:55536632-55536654 CACAGAAACTTAAAGTAAAAGGG + Intergenic
1097295700 12:57960040-57960062 CACATAAACTTAAACTAAAGGGG + Intergenic
1097547710 12:61024769-61024791 CACATAAACTTAATGTAAAGGGG - Intergenic
1097603829 12:61728592-61728614 TACATAAACTTAAGGCAAAGGGG - Intronic
1097659954 12:62418790-62418812 GACATAAACTTAAGGTAAAGGGG + Intergenic
1097760796 12:63461628-63461650 CTCATAAACTTAAAGTACAGGGG + Intergenic
1097953285 12:65456701-65456723 CTCTTAAATTTAAAGAAAAGAGG + Intronic
1098223879 12:68300441-68300463 CATATAAGCTCAAGGTAAAGGGG + Intronic
1098500798 12:71189333-71189355 CACATAAACTGAAGGTAAAGGGG + Intronic
1098518818 12:71411483-71411505 GTCATAAACTTAAGGTAAAGGGG + Intronic
1098654536 12:73011431-73011453 TACATAAACTTAAGGTAAAGGGG - Intergenic
1098786260 12:74760242-74760264 CACATAAACTTAAGGTAGAGGGG - Intergenic
1098960671 12:76737017-76737039 CACATAAACTTAAAGTAAAGGGG - Intergenic
1098982481 12:76972416-76972438 CACATAAACTTAAAGTAAAGGGG - Intergenic
1099010411 12:77284853-77284875 CTCAAAAACTTAAACAAAAGAGG + Intergenic
1099042182 12:77669477-77669499 CACATAAACTTAAGGTAAAGGGG + Intergenic
1099392222 12:82095991-82096013 AACATAAACTTAAGGTAAAGGGG - Intergenic
1099777232 12:87149506-87149528 CACATAAACTTAAAGTAATGAGG - Intergenic
1100033008 12:90215842-90215864 TTAATAAATTTAAGGTGAAGGGG - Intergenic
1100290800 12:93213112-93213134 CACAAAAACTTAAAATAAAGGGG - Intergenic
1100697046 12:97106164-97106186 CACACAAACTTAAGGTAAAGGGG - Intergenic
1100918737 12:99457553-99457575 CACATAAACGTAAGGTAAAGGGG + Intronic
1100937164 12:99681893-99681915 CACATAAACTTAAGGAAAAGGGG + Intronic
1100951510 12:99855179-99855201 CACATAAACTTAAGGTGAAGGGG + Intronic
1100970649 12:100066153-100066175 CACACAAACTTAAGGTAAAGGGG + Intronic
1101226938 12:102697383-102697405 CACATAGACTGAAAGTAAAGGGG + Intergenic
1101290588 12:103363621-103363643 CACACAAACTTAAGGTAAAGGGG + Intronic
1101298052 12:103446636-103446658 CACATAAACTTAAGGTAAAGGGG + Intronic
1104524471 12:129505887-129505909 CACATAAACTTAAGGTAGAGGGG - Intronic
1104741659 12:131179991-131180013 CTTATAGACTCAAGGTAAAGGGG + Intergenic
1105598678 13:21865331-21865353 CACATAAACTTAAGGTAAAGTGG - Intergenic
1105735270 13:23262280-23262302 CTCATAGACTCAAGGTTAAGGGG + Intronic
1105908479 13:24837001-24837023 CACATAAACTTGAACTAAAGGGG + Intronic
1105990197 13:25612987-25613009 CACATGAACTTAAGGTAAAGGGG - Intronic
1106060164 13:26282841-26282863 CACATAAACTTAAGGTAAAAGGG + Intronic
1106392050 13:29344513-29344535 CACATAAACTTAAGGTAGAGGGG - Intronic
1106937958 13:34745432-34745454 CACATAAACTTAAAGTAAACAGG - Intergenic
1106977954 13:35245160-35245182 CACATAAAATTAAGGTAAAAGGG - Intronic
1107070916 13:36267728-36267750 CATATAAACTCAAGGTAAAAGGG + Intronic
1107361396 13:39621224-39621246 CACATAAACATAAGGTAAAGGGG + Intergenic
1107426617 13:40300210-40300232 CATGTAAACTTAAGGTAAAGGGG - Intergenic
1107666088 13:42692549-42692571 CACATAAACTTAAAGTAAAGAGG - Intergenic
1108132084 13:47312347-47312369 CACATAAACTTAAGGTAAAGAGG + Intergenic
1108134542 13:47341049-47341071 CACATAAACTTAAGGTAAAGGGG + Intergenic
1108134746 13:47343527-47343549 CACATAAACTTAAGGTAAAGGGG + Intergenic
1108298532 13:49051011-49051033 AACATAAACTTAAGGTAAAGGGG - Intronic
1108469584 13:50754537-50754559 CACATAAACTTAAAGTAAAGGGG - Intronic
1108815771 13:54288008-54288030 TTAATAGACTCAAGGTAAAGAGG - Intergenic
1109047702 13:57435354-57435376 CACATAAAGTTAAAGTAAAGGGG - Intergenic
1109058130 13:57579216-57579238 CACATAAACTTAAGGTAAGAGGG - Intergenic
1109125333 13:58510391-58510413 CACATAAACTTAAAGTAAAGGGG + Intergenic
1109201157 13:59433043-59433065 TGCATAAACTTAAGGTAAAGAGG - Intergenic
1109484749 13:63003831-63003853 CACATAAACTTAAGGTGAAGGGG + Intergenic
1109504098 13:63276352-63276374 CTTATAGACGGAAGGTAAAGAGG + Intergenic
1109508183 13:63334756-63334778 CACATAAATTTAAAGTAAAGGGG - Intergenic
1109567379 13:64134932-64134954 CACATAAACTTAAGGTAAAGAGG - Intergenic
1109596896 13:64568395-64568417 CACATAAACTTAATGTAAAGAGG - Intergenic
1109618081 13:64863159-64863181 CACATAAACTTAAGGTAAAGGGG - Intergenic
1109625192 13:64964755-64964777 CACAGAAACTTAAGGTAAAGTGG + Intergenic
1109822438 13:67675636-67675658 CTCATGAACTTAAGGTAAAGGGG - Intergenic
1109824415 13:67698739-67698761 CTCATAAACTTAAGGTAAAGGGG + Intergenic
1109900009 13:68755768-68755790 CTCATAAATTTCAGGTGAAAAGG + Intergenic
1109945511 13:69426279-69426301 CATATAAACTTAAAGTAAAGTGG + Intergenic
1110504917 13:76274030-76274052 CACATAAACCTAAGGTAAAGGGG + Intergenic
1110627768 13:77670357-77670379 CATATAAACTTAAAATAAAGGGG + Intergenic
1110748266 13:79081350-79081372 CACATAAACTTAAGGCCAGGTGG + Intergenic
1110755936 13:79173923-79173945 CACATAAACTTAAGGTAAAGGGG + Intergenic
1110946166 13:81421276-81421298 CTTATAGACTCAAGGTAAAGGGG - Intergenic
1111080303 13:83297592-83297614 CCCATAAGCTCAAAGTAAAGGGG - Intergenic
1111145069 13:84168659-84168681 TCCACAGACTTAAGGTAAAGGGG - Intergenic
1111148671 13:84218684-84218706 CACATAAAATTAAGATAAAGGGG + Intergenic
1111160758 13:84392156-84392178 CACAATAACTTAAGATAAAGGGG - Intergenic
1111283219 13:86053821-86053843 CACATAAACTTAAGGTAAAGGGG + Intergenic
1111748155 13:92295823-92295845 CACACAAACTTAAGGTAAAGGGG - Intronic
1112035199 13:95491119-95491141 CACATAAACTTAAAGTAAAGGGG - Intronic
1112087192 13:96043641-96043663 CACATAAACTTAAGGTAAAGGGG + Intronic
1112346492 13:98594303-98594325 CCCATAACCTTCAGGTAATGGGG - Intergenic
1112738327 13:102445627-102445649 CACACGAACTTAAAGTAAAGGGG + Intergenic
1112747510 13:102543352-102543374 CACATAAACTTAAAGTAAATGGG + Intergenic
1112945512 13:104921925-104921947 CATAAAAACTTAAAGTAAAGGGG + Intergenic
1113084410 13:106553543-106553565 CTCATGATCATCAGGTAAAGAGG + Intronic
1113240491 13:108331105-108331127 CACATAAACTTAAGGTAAAGGGG + Intergenic
1113269750 13:108660639-108660661 CACATAAACTTAAAGTAAAGGGG - Intronic
1113845433 13:113386673-113386695 CACATAAACTTAAGGTAAAGGGG - Intergenic
1114336178 14:21692771-21692793 CTCATAAACAAAAGGAAAAAGGG + Intergenic
1114337140 14:21701760-21701782 CACATAAGCTTAAGGTAAAGGGG + Intergenic
1114691982 14:24592137-24592159 CACATAAACTTAAAGTAAAAGGG - Intergenic
1114698394 14:24649484-24649506 CTTATAGACTCAAGGCAAAGGGG + Intergenic
1114756492 14:25266133-25266155 CACATAAACTTAAGGTAAAGGGG - Intergenic
1115350439 14:32389206-32389228 CGCACAAACTTAAGGTAAAGGGG - Intronic
1115393028 14:32875506-32875528 CACATAAACTTAAGGTAAAAAGG - Intergenic
1115937919 14:38576055-38576077 CACATAAACTTAAGGTAAAGGGG - Intergenic
1115970044 14:38934668-38934690 CACATAAACTTAAAGTAAAGGGG + Intergenic
1116048843 14:39779336-39779358 CACATAAACTTAAAGTAAAGGGG - Intergenic
1116335702 14:43653407-43653429 CACACAAACTTAGGGTAAAGGGG + Intergenic
1116346954 14:43805767-43805789 CTCATAAAATGAAAGTAAAGCGG + Intergenic
1116376255 14:44205407-44205429 TTCATAAAGTTAAGGGAAAATGG + Intergenic
1116402032 14:44519405-44519427 CACATAAACTGAAAGTGAAGTGG - Intergenic
1116668850 14:47815521-47815543 CACATAAACTGAAGGTTAAAAGG - Intergenic
1117103598 14:52376504-52376526 CACATAAACTTAAGATAAAGGGG - Intergenic
1117112964 14:52477449-52477471 CACATAAACTTAAGGTAAAGGGG + Intronic
1117193241 14:53314578-53314600 CACATAAACTTAAGGTAAAGCGG - Intergenic
1117240912 14:53831474-53831496 CACATAAACTCAAGGTAAAGGGG + Intergenic
1117271559 14:54148848-54148870 CACATAAACTTAAGGTAAAAGGG + Intergenic
1117509933 14:56440940-56440962 CACATAAACTTAAAGTAAAGGGG - Intergenic
1117640030 14:57788047-57788069 CACATAGACTTAAAGCAAAGGGG + Intronic
1117655227 14:57949393-57949415 CCCATAAACTTAAGGTAAAGGGG - Intronic
1117768728 14:59109956-59109978 TGCAAAAACTTAAGGTGAAGGGG + Intergenic
1118162499 14:63303966-63303988 CACATAAACTTAAAGTAAAGGGG + Intergenic
1118165783 14:63334410-63334432 CACATAAACTTAAGGTAAAGGGG + Intergenic
1118421032 14:65603881-65603903 GACATAAACTTAAGGTACAGGGG + Intronic
1119098667 14:71858226-71858248 CACATAAACTTCAAGTAAAGGGG + Intergenic
1119719235 14:76880022-76880044 CTCATAAGCGTCAGGTATAGTGG + Intergenic
1120400147 14:84021134-84021156 CAAATAAACTTAAGGTAAAGGGG - Intergenic
1120450737 14:84664090-84664112 CACATAAACTTAAGGTAAACGGG - Intergenic
1120545570 14:85807508-85807530 CACATAAACTTAAAGTAAAGGGG - Intergenic
1120736161 14:88055612-88055634 CACATAAACTTAAGGTAAGGGGG - Intergenic
1121460065 14:94068137-94068159 CACATAAACTTAAAGTAAAGGGG + Intronic
1121475838 14:94201682-94201704 CACATAAACTTAAGGTAAAGGGG - Intronic
1121503272 14:94456885-94456907 CACATAAATGTAAGGTAAAGGGG - Intergenic
1121848244 14:97194603-97194625 CACCTAAACTTAAGGTAAAGGGG - Intergenic
1121978302 14:98427384-98427406 GTCATAAAGTCAAGGCAAAGCGG + Intergenic
1124505312 15:30267492-30267514 CACATAAACTTAAGGTAAAGGGG + Intergenic
1124557332 15:30738255-30738277 CACATAAACTTAAAGTAAAAGGG + Intronic
1124673931 15:31667492-31667514 CACGTAAACTTAAAGTAAAGGGG - Intronic
1124738240 15:32271139-32271161 CACATAAACTTAAGGTAAAGGGG - Intergenic
1125145644 15:36464910-36464932 CTTATAAACTCAAGGTAAAGGGG - Intergenic
1126184456 15:45818382-45818404 CACGTACACTTAAGGTAAAGGGG - Intergenic
1126244763 15:46491350-46491372 CAGATAAACTTAAAGTAAAGGGG + Intergenic
1126488407 15:49209019-49209041 CACATAAACTTAAAGTAAAGGGG - Intronic
1126521242 15:49596748-49596770 CACATAAACTTAAGGTAAAGGGG + Intronic
1126566125 15:50101366-50101388 CACATAAACTTAAGGTAATGGGG + Intronic
1126572927 15:50170834-50170856 CACATAAACTTACAGTAATGGGG + Intronic
1126577737 15:50213079-50213101 CACATAAACTTAAAGTAAACAGG + Intronic
1127036303 15:54921986-54922008 CGCATAAACTTAAGGTAAAGGGG - Intergenic
1127188178 15:56502277-56502299 CACATAGACTGAAAGTAAAGGGG + Intergenic
1127194666 15:56570677-56570699 CACATAAGCTTAAGGTACAAGGG + Intergenic
1127573762 15:60270528-60270550 CATATAAACTTATGGTAAAGGGG - Intergenic
1127694475 15:61431624-61431646 CACATAAACTTAAGGTAAAGGGG - Intergenic
1129562643 15:76588459-76588481 CACATAAACTTAAGGTAAAGGGG - Intronic
1130749565 15:86696446-86696468 CATATAGACTTAAGGTAAAAAGG - Intronic
1130779765 15:87023256-87023278 CACACAAACTTAAGTGAAAGGGG + Intronic
1131828511 15:96339460-96339482 CTCACAGACTGAAGGTAAAGGGG - Exonic
1132033591 15:98459754-98459776 CACATAAACTTAAGATAAAGGGG + Intronic
1132253911 15:100357387-100357409 CACATAAACTTAAGGTAAAAGGG + Intergenic
1133952937 16:10413025-10413047 CACATAAGCTTAAGGTAAAGGGG - Intronic
1134805816 16:17123998-17124020 CACATGAACTTAAGGTAAAAAGG - Intronic
1135203047 16:20455925-20455947 CACATAAACTTAAGGTAAGGGGG + Intronic
1135216052 16:20571936-20571958 CACATAAACTTAAGGTAAGGGGG - Intronic
1135289236 16:21220576-21220598 CACATAAACTTAAAGTAAAGGGG - Intergenic
1135901840 16:26467037-26467059 CACATAAACTTAAAGCAAAGGGG + Intergenic
1137418571 16:48310163-48310185 CACACAGACTGAAGGTAAAGGGG - Intronic
1138101851 16:54258202-54258224 CTCATAAACAAAAGGTATACTGG + Intronic
1138192314 16:55024084-55024106 CACATAAACTTAAGGTAAAGGGG + Intergenic
1138308384 16:56001095-56001117 TTTATAAACTCAAGGTGAAGTGG + Intergenic
1140531010 16:75666058-75666080 CACATAAACTTAAGGTAAAGGGG + Intronic
1142840963 17:2629948-2629970 CACATAAATTTAAAGTAAAGGGG - Intronic
1142910589 17:3087365-3087387 CACATAAACTTAAGGCAAAGAGG - Intergenic
1142940128 17:3373658-3373680 CATGGAAACTTAAGGTAAAGGGG - Intergenic
1144139467 17:12334738-12334760 CACATAAACTTAAAGTGAAGGGG - Intergenic
1144278168 17:13697376-13697398 CACATAAACTTAAGATAAAGGGG - Intergenic
1146136015 17:30321755-30321777 TTCATAATCTTAAGGTATATAGG - Intronic
1146583598 17:34061650-34061672 CACATAAACTTAAAGTAAAGGGG + Intronic
1146751245 17:35383098-35383120 CACATACACTTAAAGTAAAGGGG - Intergenic
1147777677 17:42914364-42914386 CTCATAAACTTCAGGGAGTGGGG - Intergenic
1148400388 17:47354730-47354752 CACATAAACCTAAGGTAAAGGGG - Intronic
1148408050 17:47437624-47437646 CAAATAAACTTAAAGTAAAGGGG - Intronic
1149122203 17:53183253-53183275 CACATAAACTTAACGTGAAGGGG - Intergenic
1149221592 17:54420458-54420480 CACATAAACTTAAGGTTAAGGGG + Intergenic
1150034918 17:61784364-61784386 CTCACCAATTTATGGTAAAGAGG - Exonic
1150528850 17:65955626-65955648 CACATAAACTTACAGTAAAGGGG + Intronic
1150818565 17:68415880-68415902 CGCATACATTTAAAGTAAAGGGG - Intronic
1150896086 17:69212813-69212835 CACATAAACTTAAGGTAAAGGGG - Intronic
1150945282 17:69739372-69739394 CACATAAACTTAAAGTAAAAGGG - Intergenic
1151079011 17:71306717-71306739 CACATAAACTTAAGGTAAAGGGG + Intergenic
1151138476 17:71970056-71970078 CTCATAAGGTGAAGGTGAAGAGG + Intergenic
1152949651 17:83221531-83221553 CACAAAAACTTAATGGAAAGAGG + Intergenic
1153065656 18:1041681-1041703 CGTGCAAACTTAAGGTAAAGTGG + Intergenic
1153532792 18:6066722-6066744 CACATAAACTTAAGGTAAAGGGG - Intronic
1153556376 18:6318380-6318402 CATATAAATTCAAGGTAAAGTGG + Intronic
1153828960 18:8902953-8902975 CACATATACTTAAGGTAAAGGGG + Intergenic
1153869677 18:9305953-9305975 CACATAAACTTAAAGTAAAGGGG + Intergenic
1153965729 18:10180291-10180313 CACATAAACTTTAAGTAAATGGG - Intergenic
1154090199 18:11351352-11351374 CACATAAACTTAAGGTAAAGGGG + Intergenic
1154339514 18:13491687-13491709 GTCATAAAGTTAATGTCAAGTGG + Intronic
1154985866 18:21550219-21550241 CTCATCAACTTAACGTAATTGGG + Intronic
1155286978 18:24299092-24299114 CATATAAACTCAAGGTAAAGGGG - Intronic
1155573631 18:27222042-27222064 CACATAAACTTAATGTAAAGGGG - Intergenic
1155771610 18:29708080-29708102 CATATAAACTCAAAGTAAAGGGG - Intergenic
1156326862 18:36081734-36081756 CACATAAACTTAAGGAAAAGGGG + Intergenic
1156606934 18:38677967-38677989 CAAGTAAACTTAAGGTAAAGGGG - Intergenic
1156642708 18:39121492-39121514 CACATAAACTTCAGGTAAAGGGG + Intergenic
1156643186 18:39126744-39126766 CACAGAAATTTAAGGTAAAGGGG + Intergenic
1156893169 18:42213619-42213641 CACATAAACTTAAGGTAAAGGGG - Intergenic
1157218791 18:45809014-45809036 CACATAAACTTAAGGTAAAGGGG + Intergenic
1157507700 18:48240975-48240997 CACATAGACTTAAGGTTAAGGGG + Intronic
1157541047 18:48507264-48507286 CACATAAACTTAAACTAAAGGGG + Intergenic
1158377436 18:56886750-56886772 CATGTAAACTTAAGCTAAAGCGG + Intronic
1158455282 18:57600933-57600955 AGCATTAATTTAAGGTAAAGAGG - Exonic
1158577814 18:58654710-58654732 CACATAGACTAAAAGTAAAGAGG - Intergenic
1158586682 18:58744659-58744681 CTCATAAACTTAAGGTATTTTGG - Intronic
1158656567 18:59340997-59341019 CACATAGACTGAAAGTAAAGAGG + Intronic
1159305689 18:66639386-66639408 CTCATAAGCATAAGTTATAGAGG + Intergenic
1159403912 18:67975507-67975529 TCCATAGACTTAAAGTAAAGGGG - Intergenic
1159453845 18:68636772-68636794 CATATACACTTAAGGTAAAGGGG - Intergenic
1159612676 18:70544153-70544175 CACAAAAACTTAAGGTAAAGGGG - Intergenic
1159838641 18:73371251-73371273 CACATAAACTAAAAGTAAAGGGG + Intergenic
1159906794 18:74099691-74099713 CACATAAACTTAAGGTAAAGGGG + Intronic
1160059029 18:75512953-75512975 CACATAAACTTAAGGTAAAGGGG + Intergenic
1160267419 18:77352111-77352133 CACATAAACTTGAAGTAAAGGGG - Intergenic
1162006362 19:7782735-7782757 CTCATAAATGTAATGTAGAGAGG + Intergenic
1164267617 19:23634761-23634783 CGCAAAAACTTAAGGTAAAGTGG + Intronic
1164288586 19:23846179-23846201 CATATAAACTAAAAGTAAAGGGG - Intergenic
1164319935 19:24135299-24135321 CACATAAACTTAAAGTAAAGGGG - Intergenic
1164422609 19:28108645-28108667 CATATAAACTCAAGGTAAAGGGG + Intergenic
1166262931 19:41654684-41654706 CACATAAACTTAAGGTAAAGGGG + Intronic
1166428903 19:42706079-42706101 CATGTAAACTTAAGGTAAAAGGG - Intronic
1166442499 19:42827100-42827122 CACATGAACTTAAGGTAAAAGGG - Intronic
1166450300 19:42893559-42893581 CACATAAACTTAAGGTAAAAGGG - Intronic
1166479464 19:43157819-43157841 CACATGAACTTAAGGTAAAAGGG - Intronic
1166551029 19:43666297-43666319 CTCAGAAACCTAAGGTTGAGAGG - Intronic
1166604051 19:44124878-44124900 CATATAAACTTAAAGTAAAAGGG - Intronic
1166899876 19:46051761-46051783 CACATAAACTTAAGGTAAATGGG + Intronic
924992656 2:326892-326914 GACATAAACTTAAAGTAAAGGGG - Intergenic
925127263 2:1468052-1468074 CACATAAACTTAAGGTAAAGGGG - Intronic
925270450 2:2602975-2602997 CTCCTCAACTTATGGAAAAGTGG + Intergenic
925705730 2:6683336-6683358 CCCATAAATTTAAGGCAAAGGGG + Intergenic
925725885 2:6870648-6870670 CTCCTAAACTTGGGGTCAAGAGG - Intronic
925795498 2:7537844-7537866 CACATAAACTTAAGGTAAAGGGG - Intergenic
926257746 2:11223167-11223189 CTGATAAACTCAAAGTAAAATGG - Intronic
926560378 2:14410301-14410323 CACATAAACTGAAAGTAAAGCGG + Intergenic
926915799 2:17891272-17891294 CACAGAAACTTAAAGTAAAGGGG - Intronic
926990422 2:18674156-18674178 CTTATAGACTTCAGGTAAAGGGG - Intergenic
927036524 2:19183320-19183342 CACATAAACTTAAGGTAAAGGGG - Intergenic
927069753 2:19515322-19515344 AACATTCACTTAAGGTAAAGGGG - Intergenic
927363297 2:22262966-22262988 CACATAAACTTAAGGTAAAAGGG - Intergenic
927401202 2:22713050-22713072 CACATAGACTCAAAGTAAAGTGG - Intergenic
928356894 2:30624394-30624416 CACATAAACTTAAGGTAAAGGGG + Intronic
928479939 2:31673011-31673033 CATATAAACTCAAGGTAAATGGG - Intergenic
928499354 2:31873206-31873228 CACATAAACTTAACCTAATGTGG + Intronic
928685192 2:33742544-33742566 CACATATACTTAAGGTAAAGGGG - Intergenic
928734496 2:34270719-34270741 CAGATAAAATTCAGGTAAAGTGG - Intergenic
928798669 2:35058472-35058494 CACATAAACTTAAGGTAAAGGGG - Intergenic
928988666 2:37206928-37206950 CACATAAACTTAAGGTAAAGGGG + Intronic
929010080 2:37433235-37433257 CACATAAACTTAAGGCAATGGGG - Intergenic
929197294 2:39198113-39198135 CACATAAGCTTAAAGTAAAGTGG + Intronic
929398897 2:41556682-41556704 CACATAAACTTAAGGTAAAAAGG + Intergenic
930404132 2:50932357-50932379 CACATAAACTTAATGTAAAGAGG - Intronic
930423272 2:51179845-51179867 CACATAAACTTAAGGTAAAAGGG + Intergenic
930566722 2:53030032-53030054 ATGATAAACTTAAGTTACAGAGG + Intergenic
931083091 2:58797759-58797781 CTCCTTAAATTAAGGTAATGTGG - Intergenic
931136179 2:59403926-59403948 CACACAAACTTAAGGTAAAGGGG + Intergenic
931136807 2:59412376-59412398 CACACAAATTTAAGGTAAATGGG - Intergenic
931524967 2:63143284-63143306 CACATAAACTTAAAGTAAAGGGG - Intronic
931536010 2:63277529-63277551 CCCATAAATTTAAGGTAAAGAGG + Intronic
931834825 2:66087551-66087573 CATATAAATTTAAGGTAAATGGG + Intergenic
932100363 2:68894130-68894152 CACCTAAACTTAAAGTAAAAGGG - Intergenic
932925656 2:75970717-75970739 CACATAAACATAAGGTAAAGAGG + Intergenic
933086126 2:78056581-78056603 CACATAAACTTAAGGTAAAAGGG - Intergenic
933110959 2:78399380-78399402 CACATAAAATTAAGGTAAAGGGG + Intergenic
933382211 2:81563247-81563269 CACATAAAGTAAAGGTAAAGGGG - Intergenic
933398114 2:81757088-81757110 CACATACAATTAAGGTAAAGTGG + Intergenic
933410924 2:81923939-81923961 CACATAAACTTAAGACAAAGGGG + Intergenic
933433282 2:82212912-82212934 CACATAAACTTAAGGTTAAGAGG - Intergenic
933627359 2:84616554-84616576 CACATAAACTTAAGGTAAAGGGG - Intronic
934012388 2:87836858-87836880 CCCATAAGCTCAAAGTAAAGAGG + Intergenic
934111160 2:88744858-88744880 CACATAAACTTACTGTAAAGGGG - Intronic
935000777 2:99012460-99012482 CACATAAACTTAAGGTTAAAGGG + Intronic
935007312 2:99091579-99091601 CACATAAACTTAAGGTAAAGGGG + Intronic
935137368 2:100319629-100319651 CTCACAAACATAATGTTAAGTGG - Intronic
935516248 2:104043234-104043256 TACATATACTTAAGTTAAAGTGG + Intergenic
935610254 2:105015658-105015680 CACATAAACTTAAGGTAAAGGGG - Intergenic
935834880 2:107039311-107039333 CTCATAAGCTCAAAGTAAAGGGG + Intergenic
936084662 2:109458812-109458834 CTCTTTTACTTAAGGTAAACTGG + Intronic
936141081 2:109941018-109941040 CACATAAATTTAAGGTAAAGAGG + Intergenic
936164649 2:110109327-110109349 CAAATAAACTTAAAGTAAAAGGG + Intronic
936177769 2:110238963-110238985 CACATAAATTTAAGGTAAAGAGG + Intergenic
936203612 2:110430468-110430490 CACATAAATTTAAGGTAAAGAGG - Intronic
936701847 2:115020285-115020307 CACATAAACTTTAGGTAAAGTGG + Intronic
936776611 2:115982169-115982191 CCTATAAACTCAAGATAAAGGGG - Intergenic
936815325 2:116453955-116453977 CATATAAACTTAAGGTAAAAGGG - Intergenic
936884879 2:117298792-117298814 CTCTTAAACTCAGGGTAAAGAGG - Intergenic
936899112 2:117464292-117464314 CACATGAACTTAAGGTAAAGGGG - Intergenic
936910958 2:117593192-117593214 CACATAAACTTAAGGTAAAGGGG - Intergenic
937058066 2:118956268-118956290 CACATAAACTTAAAATAAAGGGG + Intronic
937461319 2:122089880-122089902 CACATAAACTTTAGGTAAAGGGG - Intergenic
937480503 2:122253434-122253456 TACATAAACTTAAGGTAAAAGGG + Intergenic
937716138 2:125035680-125035702 CACAAAAACTTAAGGTAAAGGGG - Intergenic
937781780 2:125847026-125847048 CACATAAACTTAAAGTAAAGTGG - Intergenic
937798796 2:126057403-126057425 CACATGAACTTAGGGTAAAGGGG - Intergenic
937828768 2:126397543-126397565 CATATAAACTTAAGGTAAAGTGG - Intergenic
938037841 2:128051055-128051077 CATATAAACTTAAAGTAAAGGGG - Intergenic
938175564 2:129124144-129124166 CTTATAGACTCAAGGTAAAGGGG - Intergenic
938853906 2:135290460-135290482 CACATAAACTTAAGGTAAAGCGG - Intronic
939149693 2:138458294-138458316 CAGATAAACTTAAAGTAAAGTGG + Intergenic
939219527 2:139283549-139283571 AACATAAACTTAAGGTAAAGGGG + Intergenic
939245575 2:139619412-139619434 CACATAAACATCAGGTAAAGGGG - Intergenic
939769763 2:146300680-146300702 CACATAAATTTAAAGTAAAGGGG + Intergenic
939847456 2:147265671-147265693 CACATAAACTAAAAGTGAAGGGG - Intergenic
940034507 2:149299911-149299933 CATATAAAATTAAAGTAAAGGGG - Intergenic
940387301 2:153088834-153088856 CACATAAACATAAGGTAAAGGGG - Intergenic
940544604 2:155067715-155067737 CTTATAGATTCAAGGTAAAGTGG - Intergenic
940618485 2:156081977-156081999 CACATAAACTTAAAGTAAAGTGG - Intergenic
940630514 2:156231985-156232007 CACATAAACTTAAGGTAAAGGGG + Intergenic
940709201 2:157142186-157142208 CACATAAACTTAAAGTAAAGGGG - Intergenic
940762551 2:157753088-157753110 CAAATAAACTTAAGGTAAATGGG + Intronic
940796617 2:158087353-158087375 CACATAAACTTAAGGTAAAGGGG - Intronic
940802413 2:158147246-158147268 TACACAAACTTCAGGTAAAGGGG + Intergenic
941358174 2:164517641-164517663 CACATAAACTTAAGGTAAAGGGG + Intronic
941519289 2:166519282-166519304 CTCAGAATCTGAAGGTTAAGAGG - Intergenic
942199505 2:173556819-173556841 CTCTTAAACATAAGCTAAAATGG - Intergenic
942405521 2:175649828-175649850 ATTATAAACTTAAGGTAAAGGGG + Intergenic
942743820 2:179208999-179209021 CACATAAACTTAAGGTAAACAGG + Intronic
943149735 2:184097285-184097307 CACATAAACTTAAGGTAAAGGGG - Intergenic
943199003 2:184794781-184794803 CATATAAACTTAAGGTAAAGGGG + Intronic
943208403 2:184930195-184930217 CTCATAAATTTTAGGTATACAGG - Intronic
943449181 2:188026878-188026900 CAAATAAACTTAAGATAAAGGGG - Intergenic
943607664 2:189995479-189995501 CATGTAAACTTAAGGTAAAAGGG - Intronic
943654486 2:190493157-190493179 CACATAAATTTAAGGTAAAGGGG + Intronic
943891092 2:193288406-193288428 CACATAAACTTAAAGTAAAGGGG - Intergenic
943909491 2:193544519-193544541 CATATAAACTTAAGGTAAAGGGG + Intergenic
943943701 2:194031101-194031123 CAAATAAACTTAAGGTAAAAGGG + Intergenic
944423328 2:199554478-199554500 GTTTTAAACTTTAGGTAAAGTGG - Intergenic
944431837 2:199642541-199642563 CGCACAAACTTAAGGTAAAGTGG - Intergenic
944485590 2:200201825-200201847 CACATAAACTTAAAGTAAAGGGG + Intergenic
944662386 2:201932051-201932073 CTCATAAACACAAGGGAGAGAGG - Intergenic
944821584 2:203437955-203437977 CTCATCAACTTATGATAAATTGG - Exonic
945131872 2:206582405-206582427 CACATAAACTTAAAGTAAAGGGG - Intronic
945285890 2:208081072-208081094 CAGATAAACTTACGGTAAAGGGG + Intergenic
945337973 2:208615569-208615591 CACATAAACTTAAGGTAAAGGGG - Intronic
945482345 2:210358698-210358720 TATATAAACTTAAAGTAAAGGGG - Intergenic
945488202 2:210423561-210423583 CTTATAATCTCAAGGCAAAGGGG - Intergenic
945536360 2:211023229-211023251 CACAAAAACTTAAGGTAAAGGGG - Intergenic
945573932 2:211506059-211506081 CTAACAGACTTAAAGTAAAGGGG + Intronic
945861468 2:215127658-215127680 CACACAAACTTAAAGTAAAGGGG - Intronic
946501493 2:220252017-220252039 CACATAAACTGAAAGTAAAGGGG + Intergenic
946795613 2:223348420-223348442 CTTATAAACTCAAGGAAAAGGGG + Intergenic
946874741 2:224116220-224116242 CTTATAGACTCAAGGTCAAGGGG + Intergenic
947146518 2:227071176-227071198 CATATAAACTCAAGATAAAGGGG + Intronic
947456865 2:230263324-230263346 CGCATAAACTTAAAGTAAAGGGG - Intronic
947460695 2:230301907-230301929 CACATAAACTTAAGGTAAAGGGG + Intronic
948297115 2:236869017-236869039 ATCATAAAGTTAAGTTCAAGTGG - Intergenic
948531390 2:238608534-238608556 CACATAAACTTAAGGTAAACTGG + Intergenic
948576925 2:238958425-238958447 CAGAAAAACTTAAGGTAAAGGGG + Intergenic
1168780391 20:484225-484247 CTCACAAATTCAAGTTAAAGTGG + Intronic
1169335940 20:4757350-4757372 TACATAAACTTAAAGTAAAGGGG - Intergenic
1169397718 20:5249186-5249208 CACATAAACTTAAGGTAAAGGGG - Intergenic
1169517241 20:6331219-6331241 CACATAAACTTAAAGTAAAGGGG - Intergenic
1170086428 20:12537428-12537450 CACATAAACTTAAGGTAAAGGGG + Intergenic
1170124995 20:12952987-12953009 CACATTAACTTAAGGTAAAGGGG - Intergenic
1170133734 20:13051218-13051240 CACATAAACTTAAAGTAAACGGG + Intronic
1170241521 20:14172201-14172223 CACATAAACTTAAGGTAAAAGGG - Intronic
1170375675 20:15697920-15697942 CACATAAACTTAAAGTAAAGGGG - Intronic
1170720827 20:18877456-18877478 CACATAAACTTTAAGTAAACGGG - Intergenic
1170741245 20:19058706-19058728 CACATAAACTTAAGGTAAAAGGG + Intergenic
1170862947 20:20126078-20126100 CACATAAACCTAAAGTAAAGGGG - Intronic
1171027983 20:21649799-21649821 TGCACAAACTTAAGGTAAAGGGG + Intergenic
1171080378 20:22176249-22176271 CACATAAACTTAAGGTAAAGGGG - Intergenic
1171165806 20:22969347-22969369 CACATAAACTTAAAGTAAAGGGG + Intergenic
1171242097 20:23579447-23579469 TAAACAAACTTAAGGTAAAGGGG - Intergenic
1171378454 20:24713017-24713039 CTCATAAACTTAAGGTAAAGGGG - Intergenic
1173568549 20:44060031-44060053 CACATAACCTTTAGGTAAAGGGG + Intronic
1173769136 20:45642785-45642807 CACATAGACTGAAGGTAAAGAGG - Intergenic
1176524752 21:7857724-7857746 CACATAGACTTCAGATAAAGAGG - Intergenic
1176694315 21:9956578-9956600 CTCATAGATTCAAGGTAAGGGGG - Intergenic
1176906284 21:14505373-14505395 CACACAAACTTAAGGTACAGGGG + Intronic
1177069418 21:16484832-16484854 CACATAAACTTTAGGTAGAGGGG - Intergenic
1177124479 21:17179111-17179133 TACATAAACTTAAGGTTAAAGGG + Intergenic
1177195324 21:17898668-17898690 CACATAAACTTAAATTAAAGAGG - Intergenic
1177212214 21:18085148-18085170 CATATAAACTAAAAGTAAAGGGG - Intronic
1177249551 21:18575081-18575103 CACATAAACTTAAGTCTAAGGGG - Intergenic
1177364355 21:20115266-20115288 CACATAAACTTAAGATACACAGG - Intergenic
1177518198 21:22182113-22182135 CTCATAAATTTAAATCAAAGTGG - Intergenic
1177847519 21:26307828-26307850 TACATAAACTGAAAGTAAAGGGG + Intergenic
1177934951 21:27333557-27333579 CACATAAACTTAAGGTAAAGGGG + Intergenic
1178059582 21:28836786-28836808 CACATAAACTTAAAGTAAAGCGG + Intergenic
1178658772 21:34487737-34487759 CACATAGACTTCAGATAAAGAGG - Intergenic
1178733061 21:35122583-35122605 CACATAAACTTAAGGTAAAGGGG + Intronic
1178801876 21:35803194-35803216 CACATAAACTTAAAGTAAAGGGG + Intronic
1179083958 21:38200637-38200659 CACATAAACTTAAGTTAAAGGGG - Intronic
1179428071 21:41297283-41297305 GTGATAAACTTAGGGTAGAGTGG - Intergenic
1179467572 21:41587288-41587310 CACATAAACTTAAGGTAAAGGGG - Intergenic
1180040074 21:45272185-45272207 CACACAAACTTAAGGTAAAGGGG + Intronic
1180642782 22:17312344-17312366 TGCAGAAACTTAAGGTAAAGAGG - Intergenic
1180862214 22:19090675-19090697 CTCTCAAACTACAGGTAAAGTGG + Intronic
1181454475 22:23048908-23048930 CACATAAACTTAAGATAAAGGGG + Intergenic
1182199028 22:28550834-28550856 CATATAAACTTAAGGCAAAGGGG + Intronic
1182682822 22:32095716-32095738 CACATAAATTTAAGGTAAAAGGG - Intronic
1183048160 22:35238593-35238615 CACGTAAACTTAAAGTAAAGGGG - Intergenic
1184063790 22:42103281-42103303 CACATAAACTTAAGGTAAAGGGG - Intergenic
949749516 3:7334695-7334717 CACATAAACTTAAGGTAAGTGGG + Intronic
950599018 3:14015288-14015310 CACATAAACTTAAGGTAAAGGGG - Intronic
951153540 3:19322052-19322074 CATGTAAACTTAGGGTAAAGGGG - Intronic
951198364 3:19849540-19849562 CACATAAACGTAAGAGAAAGGGG + Intergenic
951262042 3:20521818-20521840 CACATAAACTTAAGGCGAAGGGG - Intergenic
951302496 3:21015762-21015784 CGTATAAACTTTAGGTAAAGGGG - Intergenic
951326165 3:21304087-21304109 CATATAAACTTAAGCTAAAGGGG + Intergenic
951404817 3:22282961-22282983 CTCATAAACTTAAGGTAAAGGGG + Intronic
951467997 3:23022638-23022660 CATGCAAACTTAAGGTAAAGGGG + Intergenic
951690822 3:25394764-25394786 CACATAAACTTAAGGTAAAGGGG - Intronic
951727100 3:25772504-25772526 AACATAAACTTAAGGTAAAGGGG - Intronic
951766160 3:26202005-26202027 TGCAGAAACTTAAGGTAAAGAGG + Intergenic
952183044 3:30939635-30939657 CACATAAACTTAAGGTAAAGAGG - Intergenic
952435040 3:33265207-33265229 CACATAAACTTAAGGTAAAGGGG - Intergenic
952601701 3:35090857-35090879 CATATAAACTTAAGGTAAAGGGG + Intergenic
952689655 3:36190318-36190340 CACACAAACTTAAGGTTAAGGGG - Intergenic
952714725 3:36468953-36468975 CACATAAACTTAAGGTAAAGGGG - Intronic
952732684 3:36655248-36655270 CACATAAATTTAAGGTAAAGGGG + Intergenic
953100937 3:39827020-39827042 CCCATAGACTGAAAGTAAAGGGG - Intronic
953382393 3:42482216-42482238 CACATAAACTTAAGGTAAGGGGG + Intergenic
953495342 3:43381343-43381365 CACATAAACTTAAGGTAAAGGGG + Intronic
954479998 3:50790169-50790191 CATATAAACTTAAGGTAAAAAGG - Intronic
955450557 3:59062708-59062730 GACATAAACTTAAGGTAAAGGGG - Intergenic
955461422 3:59187840-59187862 TCCATAAACATAAAGTAAAGGGG - Intergenic
955477344 3:59351655-59351677 CATGTAAACTTAAAGTAAAGGGG - Intergenic
957016197 3:75067662-75067684 CACATAAACTTAAAGTACAGGGG - Intergenic
957208208 3:77226626-77226648 CTGATAAACTCAAGGTAAGCTGG + Intronic
957433127 3:80139436-80139458 CACATAAACTTAAGGTAAAGGGG + Intergenic
957602116 3:82350712-82350734 CACATAAACTTAAAGTAAAGGGG + Intergenic
957646136 3:82931226-82931248 TTCATAAATATAAGTTAAAGAGG - Intergenic
957800981 3:85081168-85081190 AACATAAACTTAAGATAAAATGG - Intronic
957907085 3:86570805-86570827 TTTATAGACTGAAGGTAAAGGGG + Intergenic
957908041 3:86582932-86582954 CACATAGACTCAAGATAAAGGGG + Intergenic
957981050 3:87511063-87511085 CCCCTAAAATTAAAGTAAAGTGG + Intergenic
958003101 3:87776496-87776518 CAGATAAACTTAAAGTAAAGGGG - Intergenic
958014020 3:87916506-87916528 CACATAATCTTAAAGTAAAGGGG + Intergenic
958064356 3:88524180-88524202 CACATAAACTTAAGGTAAAGGGG - Intergenic
958066462 3:88550138-88550160 CACATACACTTAACATAAAGAGG - Intergenic
958509916 3:95035079-95035101 CACATAAACTTAAGGTAAAGGGG - Intergenic
958768535 3:98399157-98399179 CATATAAACTCAAGGTAAAGGGG + Intergenic
958770860 3:98423781-98423803 CACATAAACTTAAGGTAAAGGGG + Intergenic
958818844 3:98949632-98949654 CACATAAACTTAAGGTAAAGGGG - Intergenic
958833336 3:99115527-99115549 CTCATAAACTAATGGAAATGTGG + Intergenic
958969732 3:100598850-100598872 CAGATAAACTTAAAGTAAAGGGG - Intergenic
959047165 3:101486893-101486915 CACATAAACTTAAGGTAAAGGGG + Intronic
959424014 3:106163532-106163554 CACATAAACTTAAGGTAAAGGGG + Intergenic
959666334 3:108926290-108926312 CACATAAACTTAAGGTAAGGGGG - Intronic
959715539 3:109429334-109429356 CACATAAACTTAAGGTAAAAGGG - Intergenic
959875346 3:111375472-111375494 CACATAAACTTAAGGTAAAGAGG + Intronic
959877996 3:111408791-111408813 CACATAAACTTAAGGTAAAGGGG + Intronic
959899258 3:111641273-111641295 CATATAAACTTAAAGTAAAGGGG + Intronic
960152876 3:114268996-114269018 CACATAAACTTAAGGTAAAGGGG - Intergenic
960468456 3:118028915-118028937 CTTATAGACTCAAGGTAAAAAGG - Intergenic
960512658 3:118569857-118569879 CACATAAACTTAAAGTAAAGTGG - Intergenic
960516732 3:118610093-118610115 CACATAAACTTAAGGTAAGGGGG + Intergenic
960558080 3:119051248-119051270 CACATAAACTTAAGGTAAAGTGG + Intronic
960578312 3:119248905-119248927 CACATAAACTTAAGGTAAAGGGG + Intergenic
960712144 3:120542156-120542178 CACATAAACTTAAGGTAAAGGGG - Intergenic
960756656 3:121021045-121021067 CACATAAACTTAAGATAAAGGGG + Intronic
960769903 3:121181831-121181853 CACATAAACTTCAGGTAAAGGGG + Intronic
960782703 3:121337325-121337347 CTTACAAACTCGAGGTAAAGGGG + Intronic
961407371 3:126690518-126690540 CACATAAGTTTAAGGTAAAGGGG + Intergenic
961977899 3:131045971-131045993 CATGTAAACTTAAGGTAAAGGGG - Intronic
962013107 3:131412646-131412668 CACATAAACTTAAGGTAAAGGGG + Intergenic
962034637 3:131638317-131638339 CACATAAACTTAAGGTAAAGGGG + Intronic
962065810 3:131979546-131979568 CACATAAGTTTAAAGTAAAGGGG - Intronic
962192079 3:133321292-133321314 CACAGAAACTTAAGGTAAAGTGG + Intronic
962503174 3:136016677-136016699 CACAGAGACTTAAGGTAAAGGGG - Intronic
962530279 3:136273992-136274014 CATATAACCTCAAGGTAAAGGGG - Intronic
962709623 3:138074928-138074950 CACACAAACTTAAGGTAAAGGGG + Intronic
962861979 3:139412581-139412603 CATATAAACTTAAGGTAAAGGGG - Intergenic
963023400 3:140895212-140895234 CACATAAACTTGAGGTAAAGGGG - Intergenic
963050954 3:141143225-141143247 CACATAAACTTAAGGTAAAGTGG - Intronic
963176285 3:142300815-142300837 TACATAAACTTAAGGTAAAGGGG + Intergenic
963178623 3:142329317-142329339 CTCATAAAGTTAAGAAAAATAGG + Intronic
963213410 3:142719005-142719027 TGCATAAACTTAAGGTAAAGGGG + Intergenic
963373681 3:144436267-144436289 CACGTAAACTTAAGGTAAAGGGG - Intergenic
963401855 3:144807652-144807674 TTCACAAACGTAAGGTAATGGGG - Intergenic
963824348 3:149935240-149935262 CACATAGACTGAAAGTAAAGGGG - Intronic
963832663 3:150024839-150024861 CATATAAACTTAAGGTAAAGGGG + Intronic
964017674 3:151966869-151966891 CACATAAACTTAAGGTAGAGTGG + Intergenic
964075854 3:152690564-152690586 CACATAAACTTAAGGGAAAGGGG + Intergenic
964160841 3:153642901-153642923 CACATAAACTTAAAGTAAAGGGG + Intergenic
964252946 3:154741159-154741181 CACATAAACTTAAGGTAAAAGGG + Intergenic
964325173 3:155537522-155537544 CTCATAAACTTAAAGTAAAGGGG + Intronic
964331797 3:155610990-155611012 CATGTAAACTTAAGGTAGAGGGG + Intronic
964342674 3:155724606-155724628 CACATAAACTTAAGGTAAAGGGG - Intronic
964393559 3:156222202-156222224 CACGTAAACTTAAGGTAAAGGGG + Intronic
964457484 3:156884136-156884158 GACATAAATTTAAGGCAAAGGGG - Intronic
964557180 3:157952517-157952539 CTCCAAACCTTAAGGTAAAGTGG + Intergenic
964601046 3:158501714-158501736 CACACAAATTTAAAGTAAAGGGG - Intronic
964772831 3:160242139-160242161 CACATAAACTTAAGGTAAAGGGG + Intronic
964867675 3:161278879-161278901 CACATAAACTTAAGGTAAAGAGG + Intergenic
964916147 3:161844602-161844624 CACATAAACTTAAAGTAAAGGGG - Intergenic
965000790 3:162950133-162950155 CATATAAACTCAAGGTAAAAAGG + Intergenic
965026903 3:163313742-163313764 CACATAAACTTAAGGTAAAAAGG + Intergenic
965101741 3:164307534-164307556 CAAATAAGATTAAGGTAAAGTGG + Intergenic
965154223 3:165026110-165026132 CACACAAACTCAAGATAAAGGGG + Intronic
965184754 3:165448398-165448420 CATATAAACTTAAGGTAAATGGG + Intergenic
965216677 3:165873055-165873077 CACATAAACTTAAAGTAAGGGGG - Intergenic
965284380 3:166799305-166799327 CTCATATACTTGTGGTGAAGAGG - Intergenic
965291188 3:166883339-166883361 CATATAAATTTAAGATAAAGGGG + Intergenic
965296428 3:166953360-166953382 CACATAAACTTAAGGTAAAGGGG - Intergenic
965345347 3:167541826-167541848 CTCATAAACTTAAGGTAAAGGGG + Intronic
965745619 3:171922056-171922078 CACATAAACTTAAGGTAAAGGGG + Intronic
965867252 3:173219470-173219492 CACATAGACTGAAAGTAAAGAGG - Intergenic
965874188 3:173297636-173297658 CACACAAACTTAAGGTAAAGGGG - Intergenic
966122602 3:176538835-176538857 CACATAAACTCAAGTTAAAGGGG + Intergenic
966229724 3:177638930-177638952 CACATAAACTTAAGGTAAAGGGG - Intergenic
966352829 3:179048948-179048970 CACATAAACTTAAGGTAACAGGG + Intronic
966553086 3:181227761-181227783 CACATAAACTTAAGGTAAAAGGG - Intergenic
967099417 3:186203943-186203965 CTCTTAAACTAGAGGGAAAGAGG - Intronic
967167226 3:186792356-186792378 CAGACAAACTTAAGCTAAAGGGG - Intronic
967209284 3:187152422-187152444 CACATAAACTTAAAGTAAAGGGG + Intronic
967257315 3:187607175-187607197 CACATAAACTTAAAGTAAAGGGG - Intergenic
967651594 3:191992431-191992453 CACATAAACTTAAGGTAAAGGGG + Intergenic
967725961 3:192862692-192862714 CTCATACACTTAAGAGAAAAGGG + Intronic
967741382 3:193006602-193006624 CACATAAACTTAAAGTAAAGGGG - Intergenic
967841941 3:194012442-194012464 CTCATAAATTTAAGCTACTGGGG - Intergenic
968807275 4:2782817-2782839 CACATAAACTTAAGGTAAAGGGG - Intergenic
969165460 4:5306504-5306526 CACATAAACTTAAGGTAAAGGGG - Intronic
970215628 4:13757015-13757037 CACATAAACTGCAGGTAAAAGGG - Intergenic
970217320 4:13773407-13773429 CACATAAACTTAACGTAAAGGGG - Intergenic
970283156 4:14480407-14480429 CCCATAAACTTAAGGTAAAGGGG + Intergenic
970549104 4:17161781-17161803 CACATAAACCTAAGGTAAAGGGG - Intergenic
970658430 4:18258393-18258415 CACATAAACTTAAAGTAAAGGGG - Intergenic
970856424 4:20653703-20653725 CACATAAACTTAAGGTAAAGGGG + Intergenic
970996292 4:22270772-22270794 CACATAAATTTAAAGTAAAAGGG + Intergenic
971050217 4:22853670-22853692 CACATAAACTTAAGGTAGAGGGG - Intergenic
971182916 4:24347620-24347642 CACATACACTTAAAGTAAAGGGG - Intergenic
971417436 4:26445285-26445307 ATGATAGACTCAAGGTAAAGGGG + Intergenic
971554774 4:28000302-28000324 CACATATACTTAAGGTAAATTGG - Intergenic
971720731 4:30242658-30242680 AACATAAACTTAAGGTAAAGGGG - Intergenic
971721690 4:30253566-30253588 CATATAAACTCAAGGTAAAGGGG - Intergenic
971900858 4:32656662-32656684 CACATAAACTTAAAGTAAAGGGG - Intergenic
971958122 4:33449683-33449705 CACAACAACATAAGGTAAAGAGG + Intergenic
972063818 4:34913486-34913508 CACATAGACGGAAGGTAAAGGGG + Intergenic
972097146 4:35362600-35362622 CACATAAACTTAAGGTAAAAGGG - Intergenic
972151978 4:36103756-36103778 CTCATTCATTTAAGGTAAGGAGG - Intronic
972899585 4:43667069-43667091 CACATAAAGTTAAGGCAAAGAGG - Intergenic
973070654 4:45854510-45854532 TACATAAACTTAAGGTAAAGGGG - Intergenic
973179378 4:47249792-47249814 CACATAAACTTAAAGTAAAAGGG - Intronic
973244322 4:47994534-47994556 CACATAAACTTAAGATAAAGGGG - Intronic
973342869 4:49024208-49024230 CACCTAAACTTAAGGTAAAGGGG - Intronic
973675854 4:53262116-53262138 CACATAAACTTAAGGTAAAGGGG - Intronic
973831312 4:54762683-54762705 CCCACAAACTTAAGGTAAAGGGG - Intergenic
973920338 4:55677720-55677742 CACACAAAGTTAAGATAAAGGGG + Intergenic
974194440 4:58553714-58553736 TTCATGAACTTCAGGTGAAGGGG + Intergenic
974583282 4:63835306-63835328 CACATAAACTTAAGGTAAAGGGG - Intergenic
974721811 4:65749770-65749792 CTCATAAAAGGAAGGTACAGTGG - Intergenic
975034164 4:69660339-69660361 CATATAAACTTCAAGTAAAGTGG + Intergenic
975061895 4:70013725-70013747 CACAAAAACATAAGATAAAGGGG - Intergenic
975243613 4:72092702-72092724 CATATAAACTTAAGGTAAAGGGG - Intronic
975517493 4:75262451-75262473 CACATAAACTTAAAGTAAAGAGG + Intergenic
975790330 4:77942739-77942761 CAAATCAACTTAAGGTAAAGAGG - Intronic
975811289 4:78172771-78172793 CTAATAAAATTAATGGAAAGAGG - Intronic
975943010 4:79670230-79670252 AACATAAACTTAAGGTAAAGGGG + Intergenic
976157222 4:82159283-82159305 CACAAAAACTTAAGGTAAAGGGG + Intergenic
976562588 4:86519485-86519507 CACATAAACTTAAGGTAAAGGGG - Intronic
976686132 4:87817595-87817617 CACATAAACTTAAAGTAAAGGGG - Intergenic
976762507 4:88565589-88565611 CACATAAACTGAAAATAAAGGGG - Intronic
976869763 4:89776753-89776775 CACATAAACTTAAGGTAAAGGGG + Intronic
976888052 4:90009658-90009680 CACATAAACTTAAGGTAAAGGGG + Intergenic
976907672 4:90260620-90260642 CACATAAACTCAAGGTCAAAGGG - Intronic
976918332 4:90406138-90406160 CACATGAACTTAAGATAAAGGGG + Intronic
976962912 4:91001619-91001641 CAAATAAATTTAAGGTAAAGGGG - Intronic
977474127 4:97483349-97483371 CACATAAACTTAAAGTAAAGGGG + Intronic
977489426 4:97693313-97693335 CACATAAACTTAAGGTAAAAGGG + Intronic
977510702 4:97958518-97958540 CATATAAACTTAAGGTAAAGGGG + Intronic
977552288 4:98454975-98454997 CAAATAAACTTAAGGTAAAGTGG - Intergenic
977635719 4:99295585-99295607 CACATAAACTTAAGGTAAAGGGG + Intergenic
977716351 4:100188415-100188437 CACATAAATTTAAAGAAAAGTGG - Intronic
977762958 4:100761157-100761179 CCCATAAACTTAGGGTAAAGGGG + Intronic
977813686 4:101388555-101388577 TACATAAATGTAAGGTAAAGGGG - Intergenic
977826253 4:101535275-101535297 CACATATATTTAAGGTACAGAGG + Intronic
977905889 4:102477536-102477558 AACATAAGCTTAAGGTGAAGGGG + Intergenic
978726482 4:111975789-111975811 CATATAAACTTAAAGTAAAGGGG - Intergenic
978762028 4:112363333-112363355 CACATAAACTTAAGGTAAAGGGG + Intronic
978916321 4:114129644-114129666 TGCATAAACTTAGGGTAAAGGGG + Intergenic
978999236 4:115197601-115197623 CACATAAACTTAAACTAAAGGGG - Intergenic
979020519 4:115491002-115491024 CACATAAACTTAAGGTAAAGGGG + Intergenic
979195234 4:117913399-117913421 CATATAAACTCAAGGTAAAGGGG - Intergenic
979357181 4:119717990-119718012 CACATAAACTTAAGGTAAGGGGG + Intergenic
979381894 4:120016557-120016579 CACATAAACTTAAAGTAAAAGGG - Intergenic
979434936 4:120676599-120676621 CACATACACTCAAAGTAAAGAGG + Intergenic
979461732 4:120991504-120991526 CACAGAAACTTAAGGTAAAGGGG - Intergenic
979498931 4:121417000-121417022 CACATGAACTTAAGGTAAAGGGG - Intergenic
979500783 4:121437511-121437533 CACATAGACTGAAAGTAAAGAGG - Intergenic
979593009 4:122502057-122502079 TTCTTAAACTTCAGTTAAAGGGG - Intergenic
979712488 4:123796495-123796517 CACATAAACTTAAGGTAAAGGGG - Intergenic
979794731 4:124832927-124832949 CACATAAACTTAAAATAAAGGGG - Intergenic
979794741 4:124833092-124833114 CACATAAACTTAAAATAAAGGGG - Intergenic
980087012 4:128401965-128401987 CACATAAACTTAAAGTAAAGGGG - Intergenic
980087596 4:128407752-128407774 CACATAAACTTAAGGTAAAGGGG - Intergenic
980153017 4:129071662-129071684 CACATAAACTTAAAGTGAAGGGG - Intronic
980186878 4:129473502-129473524 CACGTAAGCTTAAGATAAAGGGG - Intergenic
980366935 4:131816808-131816830 CTCATAGACTCAAGGTAAGGGGG - Intergenic
980519124 4:133908326-133908348 CCAGTAAACTTAAGGTATAGGGG - Intergenic
980536393 4:134128951-134128973 CATATAAACTTAAGGTAAAGGGG + Intergenic
980580311 4:134741917-134741939 CACATAAACTTAAAGTAAAGGGG - Intergenic
980644904 4:135631270-135631292 CACATAAACTTAAGATAAAGGGG - Intergenic
980860880 4:138498217-138498239 CACATAAACTTACAGTAAAGAGG - Intergenic
981167885 4:141583321-141583343 CACATAAACTTAAGATAAAGGGG + Intergenic
981177506 4:141699689-141699711 CAAATAAACTTAAGGGAAACAGG - Intronic
981367114 4:143916251-143916273 CACATAAACTTAAGGTAAAGGGG + Intergenic
981376908 4:144026486-144026508 CACATAAACTTAAGGTAAAGGGG + Intergenic
981387411 4:144147836-144147858 CACATAAACTTAAGGTAAAGGGG + Intergenic
981746496 4:148057292-148057314 ATCATAACCTAAAGGCAAAGAGG - Intronic
981760589 4:148190837-148190859 CATATAAACTTAAAGTAAAGGGG - Intronic
981795694 4:148592890-148592912 CACATAAGCTTAAGCTAAAGAGG - Intergenic
981825042 4:148930402-148930424 CCCATAAACTTAAAGTAAAGGGG + Intergenic
982119411 4:152127205-152127227 CTCACAAACTTAAGGTAAAGGGG - Intergenic
982247802 4:153371522-153371544 CTCATAAAGTTTAAGGAAAGAGG - Intronic
982299332 4:153863273-153863295 CACATAAACTTAAGGTAAAGGGG - Intergenic
982398811 4:154943179-154943201 GTCATAAACTGAGGCTAAAGGGG + Intergenic
982451240 4:155554382-155554404 CACATAAACCTAAGGTAAAGGGG + Intergenic
982451249 4:155554477-155554499 CACATAAACCTAAGGTAAAGGGG + Intergenic
982451258 4:155554572-155554594 CACATAAACCTAAGGTAAAGGGG + Intergenic
982487154 4:155979766-155979788 CCCACAGACTTAAGGTAAAGGGG - Intergenic
982491954 4:156040505-156040527 CACAGAAACTTAAGGTAAAGGGG + Intergenic
982960208 4:161826755-161826777 CACATTAACTTAAGGTTAAGGGG - Intronic
982991990 4:162287985-162288007 CACGTAAACTTAAGGTAAATGGG + Intergenic
983036037 4:162866937-162866959 CACATAAACTTAAGGTAAAGGGG + Intergenic
983072569 4:163286623-163286645 CACATAAGCTTAAGGTAAAGGGG - Intergenic
983180855 4:164646803-164646825 CTCATAAGAGTAAGGTAAAATGG + Intergenic
983277645 4:165637530-165637552 CATATAAACTTAAGGTAAAGGGG + Intergenic
983477339 4:168229997-168230019 CACATAAATTTAAGGGAAAGGGG + Intronic
983544679 4:168950953-168950975 CGCACAAACTTAAAGTAAAGCGG - Intronic
983749702 4:171251190-171251212 CACATAAACTTAAGGTAAAGGGG - Intergenic
983776261 4:171610572-171610594 TACATAAACTTAAGGTAAAGAGG + Intergenic
983826075 4:172262487-172262509 CACATAAATTTAAGGTAAAGGGG - Intronic
983845400 4:172512303-172512325 CATATAAACTTAAGGTAAGGGGG - Intronic
983943324 4:173559193-173559215 GACATAAACGTAAGTTAAAGGGG + Intergenic
983962884 4:173776184-173776206 CACAGAAACTTAAGGTAAAGAGG - Intergenic
984721925 4:182980525-182980547 CACATAAACTTAAAGTAAAGGGG + Intergenic
985093103 4:186383712-186383734 CACATACACTTGAAGTAAAGGGG + Intergenic
985108072 4:186518643-186518665 CACATAAACTTAAGGTGAATGGG - Intronic
985240606 4:187927616-187927638 CACATCAACTTAAGGTAAATGGG - Intergenic
985326255 4:188774316-188774338 CACATAAACTTAAGATAAAAAGG - Intergenic
985355940 4:189118934-189118956 CACATAAACTTAAGGTAAATGGG + Intergenic
985586135 5:736095-736117 GAAATAAACTTAAGGTAAAGTGG + Intronic
985600554 5:827507-827529 GAAATAAACTTAAGGTAAAGTGG + Intronic
986259195 5:6128094-6128116 CACGTAAACTTAAGGTAAAGGGG + Intergenic
986634228 5:9804016-9804038 CACATAAACTTAAGGTAAAGGGG + Intergenic
987030213 5:13970157-13970179 CACATACATTTAAGGTAAAGGGG - Intergenic
987432764 5:17856693-17856715 CACATAGACTTCAGATAAAGTGG - Intergenic
987440447 5:17949878-17949900 CACATAAACTTAAGAGAAAGAGG - Intergenic
987563743 5:19557410-19557432 CTAATATACTTAAAATAAAGGGG + Intronic
987577919 5:19754286-19754308 CACATAAACTTTAAGTAAAGTGG + Intronic
987902076 5:24025276-24025298 AACATAACCTTAAGGGAAAGGGG + Intronic
988002390 5:25365014-25365036 CACATAAACATAAGGTAAAGGGG + Intergenic
988278255 5:29111693-29111715 CACATAAACTTAAGGTAAAGGGG - Intergenic
988344804 5:30022943-30022965 CACATAAACTTAAAGTAAAGGGG + Intergenic
988421010 5:31006261-31006283 CACATAAACTTAAGGTAAAGGGG - Intergenic
988889697 5:35601359-35601381 CACATAAACTTAAGCTAAAGAGG + Intergenic
989027542 5:37084886-37084908 CATATAAACTTAAGGTAAAGGGG + Intergenic
989355287 5:40537513-40537535 CACATAAACTTAAGGTAAAGGGG - Intergenic
989533609 5:42538022-42538044 CACATAAACTTAAAGTAAAGGGG - Intronic
989562584 5:42869024-42869046 CATGTAAACTTAAGGTAAAGAGG - Intronic
989689414 5:44122694-44122716 CATATAAACTTAAGGTAAAGAGG - Intergenic
989694178 5:44180513-44180535 CACATAAACTTAAGGTAAAGGGG - Intergenic
989727637 5:44605621-44605643 CAAATAAACTTAAGGTAAAGAGG + Intergenic
990233538 5:53741126-53741148 CACATAAGCTTAAAGTAAAGGGG + Intergenic
990572966 5:57097201-57097223 CACACAAACTTAACGTAAAGGGG + Intergenic
990775932 5:59306253-59306275 AACATAAACTTAAAGTAAAGGGG - Intronic
990891652 5:60657155-60657177 CATATAAACTAAAGGTAACGGGG - Intronic
990899542 5:60735727-60735749 CACATAAACTTAAGGTAAAGGGG - Intergenic
991414933 5:66382307-66382329 CACATAAACTTAAGGTAAAGGGG + Intergenic
991531134 5:67616090-67616112 CTTATACAATTAAAGTAAAGAGG + Intergenic
991543358 5:67753926-67753948 CACATAAACTTAAGGTAAAGGGG + Intergenic
991623175 5:68567446-68567468 CACATAAACTTAAGATAAAGGGG + Intergenic
991924076 5:71686212-71686234 CACATAAACTTGAGGTGAAGGGG + Intergenic
992012846 5:72547220-72547242 CACATAAACTGAAAATAAAGGGG - Intergenic
992057620 5:73007409-73007431 CTCATAAACTTAAATTTTAGTGG - Intronic
992239679 5:74754488-74754510 CAAATAAACTTAAGGTAAAGGGG + Intronic
992335847 5:75768693-75768715 CATGTAAACTTAAGGTAAAGGGG - Intergenic
992339891 5:75812725-75812747 CACATAAACTTAAGGTAAAGGGG - Intergenic
992520354 5:77544444-77544466 CACACAAACTTAAGGTAAAGGGG + Intronic
992572474 5:78073754-78073776 ATCATAATCTTAGGGAAAAGTGG + Intronic
993250138 5:85511475-85511497 CACATAAACTTAGAGTAAAGTGG - Intergenic
993269270 5:85773037-85773059 CACATAAATTCAAGGTGAAGAGG - Intergenic
993613969 5:90087032-90087054 CACATAAACTTAAGATGAAGGGG + Intergenic
993646294 5:90467538-90467560 CACATGAACTTAAGGTAAAAGGG - Intronic
993743475 5:91566804-91566826 CACATGAACTGAAGGTAAAGGGG + Intergenic
993883689 5:93392952-93392974 CACATAAACTTAAAGTAAAGGGG - Intergenic
994034200 5:95179920-95179942 CACATAAACTTAAGGTAAAGAGG + Intronic
994051115 5:95363865-95363887 CACATAAACTTAAGGTAGAGGGG - Intergenic
994304234 5:98182511-98182533 CACATAAACTTAAAGTAAAGGGG + Intergenic
994330071 5:98494102-98494124 CACATAAACTTAAAGTAAAGGGG + Intergenic
994358169 5:98818593-98818615 CACATAAACTTAAGGTAAATGGG + Intergenic
994398899 5:99254699-99254721 CACATAAACTTAAGGTAAAAGGG - Intergenic
994496749 5:100522168-100522190 AACATCAACTGAAGGTAAAGGGG + Intergenic
994527379 5:100923737-100923759 CACATAAACTTAAGGTAAAGTGG - Intergenic
994645899 5:102468696-102468718 CACACAAACTTAAAGTAAAAGGG - Intronic
994777970 5:104059643-104059665 CACATACACTTAAGGTAAAGGGG - Intergenic
994887548 5:105583597-105583619 CACATGAACTTAAGATAAAGGGG + Intergenic
995187230 5:109284362-109284384 CATATAAACTCAAGGTAAAGGGG + Intergenic
995317705 5:110795490-110795512 CAAAGAAACTTAAAGTAAAGGGG - Intergenic
995587736 5:113665821-113665843 CACATAAACTTAAGGTAAAGGGG + Intergenic
995722712 5:115153163-115153185 CACAAAAACTTAAGGTAAAGGGG + Intronic
995811509 5:116112331-116112353 CACATAGACTAAAAGTAAAGGGG - Intronic
995818021 5:116193451-116193473 CACATAAACTGAAAGTAAAGGGG + Intronic
996010958 5:118480969-118480991 CACATAAACTTAAAGTAAAGGGG + Intergenic
996110363 5:119558651-119558673 CACATAAACATAAGGTAAATGGG + Intronic
996141129 5:119911138-119911160 CACATAAACTTAAGGTAAAGGGG - Intergenic
996197993 5:120633497-120633519 CACATAAACTTAAGGTAAAGGGG + Intronic
996279626 5:121712943-121712965 CACATAAACTTAAGGTAAAGGGG + Intergenic
996325606 5:122269318-122269340 CACATAAACTTAAAGTAAAGGGG + Intergenic
996326808 5:122284649-122284671 CACATAAACTTAAGGTAAAAGGG - Intergenic
996632031 5:125644529-125644551 CACATGAACTCAAGGTAAAGGGG + Intergenic
996657290 5:125956205-125956227 CACATAAACTCAAGGTAAAGGGG + Intergenic
996678533 5:126204114-126204136 CACATAAACTTAAGGTAAAGGGG + Intergenic
996835202 5:127783998-127784020 CTCATAAACTTAAGGTAAAGGGG - Intergenic
996875181 5:128233301-128233323 CACATAAACTTAAGGTAAAGTGG - Intergenic
997003885 5:129796100-129796122 CACAGAAAATTAAGGTAAAGTGG - Intergenic
997058633 5:130475243-130475265 CATAGAAATTTAAGGTAAAGGGG - Intergenic
997798151 5:136832282-136832304 CACATAAACTTAAGGTAAAGGGG - Intergenic
997901055 5:137764787-137764809 CACATAAACTTGAGGTAAAGAGG + Intergenic
998746261 5:145262965-145262987 CTCATAAACTTAAGGATAAGGGG + Intergenic
998758795 5:145409498-145409520 CACATAAACTTAAGGCAAAGGGG + Intergenic
998777029 5:145615271-145615293 CACATAAACTTAAAGTAAAGGGG - Intronic
998949282 5:147375540-147375562 TTCATAAAATTATGGTAAAGGGG + Intronic
999086300 5:148893674-148893696 CACATAAACTTAAGGTAAAGGGG + Intergenic
999108866 5:149097765-149097787 CACATAAACTTAAGGTAAAGGGG + Intergenic
999337713 5:150736891-150736913 CACATAAACTTATGGTAAAGGGG + Intronic
999490944 5:152051229-152051251 CACATAAACTTAAGGTAAAGGGG - Intergenic
999677288 5:154016904-154016926 CACGTAAGCTTAAGGTAAAGGGG + Intronic
999839117 5:155405130-155405152 CACATAAACTTATGGTAAAGGGG + Intergenic
999930601 5:156429375-156429397 CACATAAATATAAGGTAAAGGGG - Intronic
1000158860 5:158580031-158580053 CACATAAAGTTAAGGTAAAGGGG - Intergenic
1000237864 5:159379417-159379439 CACATAAACTTAAGGTAAAGGGG + Intergenic
1000511418 5:162188365-162188387 CACATAAACTTAAGGTAAAGGGG - Intergenic
1000584625 5:163081693-163081715 CGCATAAACTTAAGGTAAAGGGG + Intergenic
1000856818 5:166408660-166408682 CAAACAAACTTAAGGTAATGAGG + Intergenic
1001166875 5:169376655-169376677 CACATAAACTTAAGGTAAAGGGG + Intergenic
1001176967 5:169479180-169479202 CACATAAACTTAAGGTAAAGGGG - Intergenic
1001290905 5:170458986-170459008 CAAATAAACTTAAGGTAAAGGGG + Intronic
1001619169 5:173068077-173068099 CTAATAAAACTAAGGTAAAAAGG - Intronic
1001693574 5:173652176-173652198 CATATAAACTTAAGGCAAATGGG - Intergenic
1001814971 5:174660910-174660932 CTCAGAAACTTTAGGTAGGGTGG + Intergenic
1002743883 5:181455343-181455365 CACAAAAACTTAATGGAAAGAGG + Intergenic
1002814066 6:661929-661951 CACATAAAGTTAAAGTAAAGGGG + Intronic
1002893065 6:1353881-1353903 CACATAAACTTAAGGTAAAGGGG + Intergenic
1003029226 6:2587437-2587459 CACATAAACTTAAAGTAAAAGGG - Intergenic
1003297275 6:4842631-4842653 CACATAAACTTAAGGTAAACGGG - Intronic
1003376854 6:5587747-5587769 CTCATGAACTTAAGGTAGTATGG - Intronic
1003465148 6:6372374-6372396 CACATAAACTTAAGGCTAAGGGG + Intergenic
1003582217 6:7350034-7350056 CACATAAACTTAAAGTAAAGGGG + Intronic
1003711779 6:8600925-8600947 CACATAAACTTAAAGTACAGGGG - Intergenic
1004408733 6:15360481-15360503 CTCATAAAAATAAGATAAATAGG - Intronic
1004888736 6:20076707-20076729 CACATAAACTTAAGGTAAAGGGG + Intergenic
1004959061 6:20765046-20765068 CTCATAAACTTAAAACAAACAGG - Intronic
1005072703 6:21876468-21876490 CATACAAACTTAAAGTAAAGGGG + Intergenic
1005107539 6:22240732-22240754 CACATAAACTTAATGTAAAGGGG + Intergenic
1005244292 6:23863950-23863972 CACATAAGCTTAAGGTAAAGGGG + Intergenic
1005305541 6:24510668-24510690 CACAGAAACTTAAGGTAAAGGGG - Intronic
1005395159 6:25374883-25374905 CTTATAGACTCCAGGTAAAGTGG - Intronic
1005431274 6:25759737-25759759 CACATAAACTTAAGGTAAAGAGG - Intronic
1005435357 6:25804660-25804682 CATATAAACTCAAGGTAAAAGGG + Intronic
1005691336 6:28309593-28309615 CACATAAACTTAAGGTAAAGGGG - Intergenic
1006062780 6:31437585-31437607 CACATAAACTGAAGGTAAAGGGG - Intergenic
1007891097 6:45292610-45292632 CACACAAACTTAAGGCAGAGGGG + Intronic
1008171888 6:48217967-48217989 CACATAAATTTAAGGTAAAGGGG + Intergenic
1008185587 6:48386716-48386738 CACATAAACATAAAGTATAGGGG - Intergenic
1008190477 6:48450617-48450639 CACATAAACTTAAGGTAAAGGGG - Intergenic
1008305516 6:49894178-49894200 CACATAAACTTAAAGTAAAGGGG + Intergenic
1008528427 6:52432061-52432083 CATGTAAATTTAAGGTAAAGGGG - Intronic
1008736107 6:54545994-54546016 CACTTAAACTTAAGGTAAAGGGG - Intergenic
1009267279 6:61571196-61571218 CACATAAACTTATGGTAAAGGGG + Intergenic
1009332312 6:62439364-62439386 CACATAAACTTAAGGTGAAGGGG - Intergenic
1009360103 6:62801053-62801075 CACATAAACTTAAGGTAAAGGGG - Intergenic
1009424534 6:63499854-63499876 CTCCTAGACTTAATGTAAATTGG - Intergenic
1009644568 6:66381536-66381558 TACATAAACTTGAGGTAAAGGGG - Intergenic
1009779635 6:68253801-68253823 TCCATAAACATAAGGCAAAGGGG - Intergenic
1009800060 6:68525991-68526013 CACATAAACTTAAGGTAAAGGGG - Intergenic
1009908589 6:69898861-69898883 ATCAGAAACTTAAGATAAAATGG - Intronic
1009969040 6:70606798-70606820 CACATAAACTTAAAGTAAAGGGG + Intergenic
1010045499 6:71438170-71438192 CACATAAACTTAAGGTAAAGGGG + Intergenic
1010054959 6:71554758-71554780 CACATAAACTTAAGGTAAAGGGG - Intergenic
1010076165 6:71801534-71801556 CACATAATCTTAAAGTAAAGGGG - Intergenic
1010456886 6:76066339-76066361 CTCATAGACTGAAGCTAAAGGGG + Intronic
1010458990 6:76092023-76092045 CACACAAACTTAAGGTAAAGAGG - Intergenic
1010479673 6:76336231-76336253 CACATAAACTTAATGTAAAAGGG - Intergenic
1010518273 6:76801393-76801415 CACATAAACTTAAGGTAAAGAGG - Intergenic
1010633492 6:78229202-78229224 CACATAAACTTAAGGTAACAGGG - Intergenic
1010782082 6:79955188-79955210 GTCATACATTTAAGGTAAAGTGG - Intergenic
1010817300 6:80373870-80373892 CACATAAACTTAAGGTAAAGGGG - Intergenic
1011005446 6:82639390-82639412 CATATAAACTTCAGGTGAAGGGG + Intergenic
1011093308 6:83631699-83631721 CACACAAACTTAAGGTAAAGGGG - Intronic
1011132931 6:84070928-84070950 CACAAAAACTTAAAGTAAAGGGG - Intronic
1011168835 6:84481270-84481292 CACATAAACTTAAAATAAAGGGG + Intergenic
1011210337 6:84949254-84949276 CACATGAACTTAAGGTAAAGGGG - Intergenic
1011225374 6:85099162-85099184 CACATTAACTTAAGGTAAAGGGG + Intergenic
1011319781 6:86078670-86078692 CATAAAAACTTCAGGTAAAGGGG - Intergenic
1011321011 6:86093591-86093613 CACATAAGCTTAAAATAAAGGGG - Intergenic
1011327349 6:86163740-86163762 CACATAAACTTAAAGTATAGGGG + Intergenic
1011365902 6:86582460-86582482 CACATAAACCTAAGCTAAAGGGG - Intergenic
1011373272 6:86663589-86663611 CACATAAACTTAAGGTAAAGGGG - Intergenic
1011564503 6:88660435-88660457 CAAATAAACTCCAGGTAAAGAGG + Intronic
1011589151 6:88954261-88954283 CACATAAACTTAAGGTAAAGGGG + Intronic
1011620181 6:89235290-89235312 CACATAAACTTAAGGTAAAGGGG - Intergenic
1011789523 6:90883639-90883661 CACATAAACTTAAAGTAAAGGGG - Intergenic
1011817654 6:91211723-91211745 CACATAAACTTAAAGTAAAGAGG - Intergenic
1011923779 6:92616449-92616471 CACATAAACTTAAAATAAAGGGG - Intergenic
1011940228 6:92833762-92833784 CTGATAAATTTTAAGTAAAGTGG + Intergenic
1012156159 6:95821814-95821836 CACATAAACATAAAGTAATGGGG + Intergenic
1012203211 6:96432145-96432167 CACATAAACTTAAGGTAAAGAGG - Intergenic
1012204575 6:96444509-96444531 CACATAATCTTAAGGTAAAGGGG + Intergenic
1012208170 6:96487598-96487620 CACATAAACTTAAGGTAAAGGGG - Intergenic
1012684795 6:102232555-102232577 CACATAAACTTAAAGTAAAGGGG - Intergenic
1012793997 6:103736540-103736562 CACATAAACTTAAAGTAAAGGGG + Intergenic
1012870043 6:104661495-104661517 CACATAAATTTAAGGTAAAGGGG + Intergenic
1012965841 6:105671694-105671716 CACATAAACTTAAGGTAAAGGGG + Intergenic
1013495465 6:110693011-110693033 ATAATAAACCCAAGGTAAAGGGG + Intronic
1013686250 6:112587449-112587471 CACATAAACTTAAGGTAAAGGGG - Intergenic
1013720864 6:113026762-113026784 CACACAAACTTAAAGCAAAGGGG - Intergenic
1013852444 6:114532796-114532818 CACATAAACTTAAAGTAAAGGGG - Intergenic
1013985346 6:116185730-116185752 CACACAAACTAAAGGTAAAGGGG - Intronic
1014235183 6:118946293-118946315 CACATAAACTTAAGGTAAAGGGG + Intergenic
1014285241 6:119489450-119489472 CACATAAACTTAAAGTAAAGGGG + Intergenic
1014304644 6:119725640-119725662 CACATAAACCTAAAGCAAAGGGG - Intergenic
1014337029 6:120149327-120149349 CACATAAACTTAAAATAAAGGGG + Intergenic
1014420108 6:121233572-121233594 CACATAAACTTAAGATAAAGGGG - Intronic
1014421214 6:121247590-121247612 CACATAAACTTGAGGTAAAGGGG + Intronic
1014531187 6:122561779-122561801 CACATGAACTTAAAGTAAAGGGG - Intronic
1014532227 6:122572015-122572037 CACATAAACTCATGGTTAAGGGG + Intronic
1014532235 6:122572071-122572093 CACATAAACTCATGGTAAAGGGG + Intronic
1014581573 6:123143868-123143890 CACATAAACTTAAGGTAAAGGGG + Intergenic
1014604102 6:123450361-123450383 CACATAAACTTAAAGGAAAGGGG + Intronic
1014623210 6:123695112-123695134 CTCATTAACTTAAGATGAAGTGG - Intergenic
1014658442 6:124135401-124135423 CACATAAACTTAAGGTAAAGGGG + Intronic
1014739234 6:125127724-125127746 CACATAAACTTAAAGAAAAGGGG + Intronic
1014749753 6:125242655-125242677 CACATCAACTTAAGGTAAAGAGG - Intronic
1015348059 6:132182519-132182541 CACATAAACTTAAGCTAAAGGGG + Intergenic
1015362170 6:132353004-132353026 CACATAAACTTAAAGTAAAGGGG - Intronic
1015565782 6:134569197-134569219 CACATAAACTTAAAGTAAAGGGG + Intergenic
1015663110 6:135598589-135598611 CACATAAACTTAAAGTAAAGGGG - Intergenic
1015877767 6:137841216-137841238 CACATAAACTTAAAGTAAAGGGG - Intergenic
1016018114 6:139206773-139206795 CACATAGACTTAAGGTAAAGGGG + Intergenic
1016176082 6:141078990-141079012 CACATAAATTTTAGGTAAAGGGG + Intergenic
1016197254 6:141359658-141359680 CACATAAACTTAAAGTAAAGGGG - Intergenic
1016351554 6:143174564-143174586 CACATAAACTTAAGGTAAAGGGG - Intronic
1016484850 6:144526545-144526567 CACATAAACTTAAGGCAAAGGGG - Intronic
1016498034 6:144686756-144686778 CTTATAGATTCAAGGTAAAGTGG - Intronic
1016498082 6:144687335-144687357 CTTATAGACTCAAGGTAAAGAGG + Intronic
1016630186 6:146220730-146220752 CTCATAGAGTTACAGTAAAGGGG + Intronic
1016735373 6:147472621-147472643 CACATAAACTTAAGGTAAAGCGG - Intergenic
1016900789 6:149099280-149099302 CATATAAACTAAAAGTAAAGGGG + Intergenic
1016909933 6:149188648-149188670 CACATAAACTTAAGGTAAAAGGG - Intergenic
1017296434 6:152800756-152800778 CTCATGGAATTAAGGTAAACTGG - Intergenic
1017556113 6:155571147-155571169 CACATAAACTTAAGGTAAAGGGG - Intergenic
1017647147 6:156549935-156549957 CTCATAAAATTCATTTAAAGAGG + Intergenic
1018113480 6:160559696-160559718 CACATAAACTTAAAGTAAATGGG - Intronic
1018596963 6:165491028-165491050 CACATAAACTTAGAGTAAAGGGG + Intronic
1018755467 6:166844989-166845011 AGCATAAACTTAAGATAAAGAGG + Intronic
1018781585 6:167072370-167072392 CATATAAACTTATGATAAAGGGG - Intergenic
1019122901 6:169818753-169818775 CACATAAACTTAAGGTAAATGGG - Intergenic
1019248742 6:170728572-170728594 CACAAAAACTTAATGGAAAGAGG + Intergenic
1019573029 7:1722210-1722232 CTCATGAACTTTAGAAAAAGAGG - Intronic
1020450122 7:8312179-8312201 CTTACAGACTCAAGGTAAAGGGG - Intergenic
1020873400 7:13663194-13663216 CCCGTAAATGTAAGGTAAAGGGG + Intergenic
1020892987 7:13902944-13902966 CTCATAAAGTTGAGGTAAATGGG + Intronic
1020995645 7:15260291-15260313 TACATAAACTTAAGAGAAAGGGG + Intronic
1021081721 7:16372813-16372835 CACATAAACTTAAGGTAAAGAGG + Intronic
1021175720 7:17447891-17447913 CTCATAAGCTCAAAATAAAGGGG - Intergenic
1021204488 7:17763674-17763696 CACATAAACTTAAAGTAAAGGGG + Intergenic
1022093770 7:27125216-27125238 CTCATTAACTTAAGGAACGGTGG + Intronic
1022150696 7:27601610-27601632 TTTAAAAATTTAAGGTAAAGGGG + Intronic
1022564963 7:31390198-31390220 CACATAAACTTAAGGTAAAGAGG - Intergenic
1024174940 7:46829480-46829502 CACACAAACTTAAGGTAAAGGGG + Intergenic
1024304678 7:47918111-47918133 CGCACAGACTTAAGGTAAAGTGG + Intronic
1024327813 7:48125377-48125399 GACATAAACTTAAGGTAAAGGGG - Intergenic
1024367109 7:48533860-48533882 CACATAAGCTTAAGGTAAAGGGG - Intronic
1024419460 7:49146088-49146110 CACATAAATTTAAGGTAAAGGGG + Intergenic
1024455950 7:49606853-49606875 CACATAATCTCAAGGTAAAGGGG + Intergenic
1024669092 7:51575662-51575684 CACATAAACATAAAGTAAAAGGG - Intergenic
1024782508 7:52867412-52867434 TACATAAACTCAAGGTAAATGGG + Intergenic
1024847616 7:53666456-53666478 CACATAAACTTAAGGTAAAGGGG - Intergenic
1024863244 7:53871246-53871268 CATATAGACTCAAGGTAAAGGGG + Intergenic
1024893503 7:54229474-54229496 CCTATAAACTCAAGGTAAAAGGG + Intergenic
1024900415 7:54312913-54312935 CCTATAAACTCAAGGTAAAAGGG - Intergenic
1024946962 7:54818327-54818349 CACATAAACTTAAGGTAAAGAGG - Intergenic
1025772972 7:64530438-64530460 CACATAAAATTAAAGTAAAGGGG + Intronic
1025794599 7:64727516-64727538 CACATAAACTTAAGGTAATGAGG - Intergenic
1025820806 7:64961271-64961293 CACATAAACTTAAGGTATTGGGG + Intergenic
1027295576 7:76766028-76766050 CACATAAACTTCAAGTAAAGGGG + Intergenic
1027328833 7:77069867-77069889 CACATAAACTTAAGGTAAAGGGG - Intergenic
1027562996 7:79755977-79755999 CACATAAACTTAAGGTGAAGGGG - Intergenic
1027691517 7:81352817-81352839 TGAATAAACTTAAGGTAAAGGGG - Intergenic
1027699422 7:81451200-81451222 CACATAAACTTAAAGTAAAGGGG + Intergenic
1027948317 7:84779894-84779916 CACGTAAATGTAAGGTAAAGGGG + Intergenic
1027963676 7:84979198-84979220 TGCACAAACTTAAGGTAAAGGGG - Intergenic
1028028439 7:85876658-85876680 CACATAAACTTAAAGTAAAAAGG + Intergenic
1028182817 7:87746678-87746700 CACATAAACTTAAAGTAAAGGGG - Intronic
1028197991 7:87929029-87929051 CACATAAACTTAAGGTAAAGGGG + Intergenic
1028261867 7:88676050-88676072 CACATAAACTTAAGGTAAAGGGG + Intergenic
1028502074 7:91529783-91529805 CATATAAATTTAAGGTAAAGTGG + Intergenic
1028529450 7:91822802-91822824 TCCATAAACCTAAGGTAAAGGGG - Intronic
1028626001 7:92877818-92877840 CACATACACTGAAAGTAAAGGGG + Intergenic
1028819320 7:95188347-95188369 CACATAAACTTAAGGTAAAGGGG - Intronic
1028822733 7:95231033-95231055 CACATAAACTTAAGGTAAAGGGG + Intronic
1028936672 7:96472603-96472625 CACATAAACTTAAGGTAAAGGGG - Intergenic
1028993254 7:97073329-97073351 TGCATAAACTTAAAGTAAAGGGG - Intergenic
1029786935 7:102801514-102801536 CACATAAACTTAAGGTAAAGGGG + Intronic
1029995543 7:105004522-105004544 CTCATATACTAATGGAAAAGAGG + Intergenic
1030390250 7:108919203-108919225 CACACAAACTTAAGGTAAAGGGG - Intergenic
1030456065 7:109775083-109775105 CACATAAACTTAAGGTATAGGGG + Intergenic
1030533641 7:110739340-110739362 CACATAAACTTAAGGTAAAGGGG + Intronic
1030719773 7:112856958-112856980 CACATAAACCTCAGGTAAATTGG + Intronic
1030936199 7:115587166-115587188 CACATAAACTTAAAGTAAAGGGG + Intergenic
1030972515 7:116077551-116077573 CATATAAACTTAAGGTAAAGGGG + Intronic
1031090240 7:117346110-117346132 CACATAAACTTAAGGTAAAGGGG - Intergenic
1031139071 7:117921156-117921178 CACATAAACTTAAGGTAAAGGGG + Intergenic
1031169262 7:118271831-118271853 CACATAAACTTCAGGTAAAGGGG - Intergenic
1031611761 7:123836444-123836466 CATATAAACTTAAGGTAGAGGGG - Intronic
1031740185 7:125419641-125419663 CACATAAACTTAAGATAAAGGGG + Intergenic
1031761063 7:125714183-125714205 CACATAAACTTAAAGTAAAGGGG - Intergenic
1031796724 7:126184603-126184625 CATGTAAACTGAAGGTAAAGGGG - Intergenic
1031799156 7:126221263-126221285 CACATAAACTTAACATAAAGTGG - Intergenic
1031828119 7:126591154-126591176 CACATAAGCTTAAGATAAAGAGG + Intronic
1032288900 7:130568339-130568361 CACATAAACTTAAGGTAAAGGGG + Intronic
1032448718 7:132008028-132008050 CACATAAATTTAAGGTAAAGGGG - Intergenic
1032605082 7:133341897-133341919 CACATAAATCTAAGGTAAAGGGG - Intronic
1032808377 7:135381975-135381997 CTCTTAGAATAAAGGTAAAGTGG + Intronic
1033027021 7:137784248-137784270 CAGATAAATTTAAGGCAAAGGGG + Intronic
1033259173 7:139827324-139827346 CATGTAAACTTAAAGTAAAGGGG - Intronic
1033961391 7:146918046-146918068 TGCATAAACTTAAGGTAAAGGGG - Intronic
1034007661 7:147491716-147491738 TTCATAAATTTACTGTAAAGAGG - Intronic
1034019754 7:147628751-147628773 CACATAAACTTAAGGTAAAGGGG + Intronic
1034682992 7:152945176-152945198 CATATAAACTTAAGGTAAAGGGG - Intergenic
1035121742 7:156574039-156574061 CACATAAACTTAAGATAAAGGGG - Intergenic
1035343649 7:158183152-158183174 CATATAAAGTTAAGGTAAAGGGG - Intronic
1035499303 8:78763-78785 CACAAAAACTTAATGGAAAGAGG - Intronic
1035591253 8:816073-816095 CACATAAACTTAAAATAAAGGGG - Intergenic
1036108599 8:5873356-5873378 CACATAAACTCAAGGTAAAGGGG - Intergenic
1036188500 8:6647628-6647650 CTCAGAAACATAAGTGAAAGAGG + Intergenic
1038366961 8:26946300-26946322 CACATAAACTTAAAGTAAAGAGG - Intergenic
1038908948 8:31939697-31939719 CACATCAACTTAAGATAAAGGGG + Intronic
1039030295 8:33301462-33301484 CACATAAACTTAAGGTAAAAGGG + Intergenic
1039123784 8:34177480-34177502 CACATAAACTTAAAGTAAAGGGG + Intergenic
1039641677 8:39229474-39229496 CATATACACTTAAAGTAAAGGGG + Intronic
1039642551 8:39239702-39239724 CACATAAACTTAAGGTAAAGGGG + Intronic
1039763680 8:40606037-40606059 CACATAAACTGAAGGTAAAGGGG - Intronic
1039810309 8:41042173-41042195 CACATAAACTTAAGGTAAAGGGG - Intergenic
1039811333 8:41051275-41051297 CACATAAACTTAAAGTAAAGGGG + Intergenic
1040442633 8:47460526-47460548 CAGATAAACTTAAGGTAAAGGGG - Intronic
1040529163 8:48251987-48252009 CATGTAAACTTAAGGTAAAGGGG - Intergenic
1040800446 8:51333624-51333646 CACATAAACTTAAAGTAAAGGGG + Intronic
1040867809 8:52068435-52068457 TACATAAACTTAAGGTAAAGGGG - Intergenic
1040989364 8:53333287-53333309 CACATAAACTTAAGGTAAAGGGG - Intergenic
1041150514 8:54927702-54927724 CACATAAACTTAAGGTAAAGGGG + Intergenic
1041227977 8:55719000-55719022 CACATAAACTTAAAGTAAAGGGG + Intronic
1041293461 8:56331062-56331084 CATATAAACTTAAAGTAAAGAGG - Intergenic
1041570342 8:59331265-59331287 CACATAAACTTAAAGTAAAGGGG - Intergenic
1041827716 8:62116185-62116207 CACATAGACTTAAAGTGAAGGGG - Intergenic
1041832222 8:62166825-62166847 CACATAAACTGAATGTAAAGGGG + Intergenic
1041877777 8:62710585-62710607 CACATGAACTTAAAATAAAGGGG - Intronic
1041897330 8:62940035-62940057 CACATAAACTTAAGGTAAAGAGG + Intronic
1042084387 8:65091680-65091702 CACATAAACTTAAGGTAAAGGGG + Intergenic
1042088801 8:65135733-65135755 CTCACAAACTTAAAGTAAAAGGG + Intergenic
1042164116 8:65929119-65929141 CTGATTAACTTAAGCTAAACAGG - Intergenic
1042431591 8:68712466-68712488 CATATAAACTTAAGGTAAAGGGG + Intronic
1042606729 8:70553325-70553347 CTCATGCACCTAAGGTCAAGAGG - Intergenic
1042728834 8:71908704-71908726 CACGTAAACTTAAGGTAAATGGG - Intronic
1042768240 8:72350862-72350884 CACATAAACTTAAGGTAAAGGGG - Intergenic
1042897038 8:73681752-73681774 CACATAAACTGAAGGTAAAGGGG + Intronic
1042995717 8:74695586-74695608 TACATAAATTTAAGGTAAAGGGG + Intronic
1043040977 8:75261462-75261484 CACACAAACTTAAGGTAAAGGGG + Intergenic
1043048864 8:75360285-75360307 CTCACCAACTTAAGGTAAAGGGG + Intergenic
1043107740 8:76136153-76136175 CACAGAGCCTTAAGGTAAAGAGG + Intergenic
1043143915 8:76626768-76626790 CTCATAAAATTAAGATACAATGG + Intergenic
1043270900 8:78331555-78331577 CACATAAACTTAAAGTAAAGGGG + Intergenic
1043537600 8:81223697-81223719 CACATAAACTTAAGGTAAAGAGG - Intergenic
1043556529 8:81437133-81437155 CACATAAACTTAAGATAAAGAGG - Intergenic
1043616569 8:82132241-82132263 TACATAAACTTAAGGTAAAGGGG + Intergenic
1043816682 8:84810854-84810876 CACATAAACTTAAAGTAAAGGGG - Intronic
1043876175 8:85489396-85489418 CACATAAACTTAAGGTAAAGGGG - Intergenic
1043985647 8:86692591-86692613 CACATAAACTTAAGGTAAAGGGG - Intronic
1044227800 8:89738800-89738822 CACATAAACTTAAAGTAAAGGGG + Intergenic
1044292080 8:90484117-90484139 CACATAAACTTAAGGTAAAGTGG + Intergenic
1044657143 8:94560735-94560757 CACATAAACTTAAGGTAAAGGGG - Intergenic
1044688121 8:94847615-94847637 CTAATAAACTTAAGATGAAATGG - Intronic
1044788057 8:95817293-95817315 TACATAAACTTAAGGCAAAGGGG - Intergenic
1044879664 8:96711189-96711211 CTAATAAACTCAAGGTAAAGGGG - Intronic
1044903527 8:96974146-96974168 CACGTAAACTTAAGATGAAGGGG + Intronic
1044947684 8:97406224-97406246 CACATAAACTTAAAGTAAAGGGG - Intergenic
1045095046 8:98788553-98788575 CACATAAACTTAAGCTAAAGGGG + Intronic
1045122108 8:99049025-99049047 CACATAAACTTAAGGTAAAGGGG - Intronic
1045373656 8:101549981-101550003 GTCATAAACTCAGGGTATAGTGG + Intronic
1045634660 8:104170522-104170544 CTCATAAACTTAAGGTAAAGAGG - Intronic
1045814094 8:106259664-106259686 CACGTAAACTTAAGGTAAAGGGG - Intergenic
1045878130 8:107006334-107006356 CACATAAACTTAAGGTAAAGGGG + Intergenic
1046033710 8:108815604-108815626 CACATAAACTTAAGGTGAAAGGG - Intergenic
1046075566 8:109307749-109307771 CACATAAACTTAAGGTAAAAGGG + Intronic
1046233224 8:111385676-111385698 CCTATAGACTCAAGGTAAAGGGG - Intergenic
1046326330 8:112651965-112651987 TTCATAAACTTGAGGTGATGAGG - Intronic
1046448838 8:114360321-114360343 CACATAAACTTAAGGTAAAGGGG + Intergenic
1047148023 8:122227643-122227665 CATATAAACTCAAGGTAAAAAGG + Intergenic
1047798162 8:128279258-128279280 CACATAAACTTAAGGTAAATGGG + Intergenic
1047890251 8:129301083-129301105 CACATAAACTTAAGGTAGAGGGG - Intergenic
1047937171 8:129793888-129793910 CACGTAAACTTAAGGTAAAGTGG - Intergenic
1047937226 8:129794614-129794636 CACATAAACTCAAGGTAAAGGGG - Intergenic
1048513331 8:135081628-135081650 CTAAGAAAGTTAAGGCAAAGAGG + Intergenic
1048515787 8:135109862-135109884 CCCACAAACTCAAAGTAAAGGGG - Intergenic
1048530846 8:135248981-135249003 CACATAAACTTAAGGTAAAGGGG - Intergenic
1049295780 8:141836236-141836258 CCCATAAACTTAAAGTAAAGGGG - Intergenic
1050070869 9:1812363-1812385 CTTATCAACTTAAGGTATACAGG + Intergenic
1050133418 9:2437387-2437409 CACATAAACTTAAAGTAAAGGGG - Intergenic
1050147584 9:2585477-2585499 CACATAAACTTAAAGTAAAGGGG + Intergenic
1050502894 9:6317134-6317156 CACATAAAATTAAAGTAAAGGGG + Intergenic
1050936089 9:11397221-11397243 CACATAAACTTAAGGTTAAGGGG + Intergenic
1050972123 9:11891411-11891433 CACATAAACTTAAGATAAATGGG - Intergenic
1050987946 9:12106440-12106462 CACATAAACTTAAGGTAAAGGGG + Intergenic
1051227870 9:14921654-14921676 CTGATAAACATAAGGAACAGTGG - Intergenic
1051277730 9:15413650-15413672 CACATAAACTTTAGATAAAGGGG - Intergenic
1051362887 9:16296717-16296739 CACAAAACCTTAAAGTAAAGGGG + Intergenic
1051601159 9:18876105-18876127 CACATAAACTTAAGGTAAAGGGG - Intronic
1051733392 9:20171492-20171514 CACATAAACTTAAGGCAAAGGGG + Intergenic
1051816751 9:21117622-21117644 CACATAAACTTCAGGTAAAGGGG - Intergenic
1051881357 9:21843041-21843063 CACAAAAACTTAAGGTAAAAGGG + Intronic
1051885508 9:21888682-21888704 GACATAAACTTAAGGTAAAGCGG - Intronic
1051929659 9:22369268-22369290 CATACAAAGTTAAGGTAAAGGGG + Intergenic
1051992996 9:23175968-23175990 ATCATCAACTTCAAGTAAAGTGG - Intergenic
1052006469 9:23355810-23355832 CACATAAACTTAAGGTAAAGGGG - Intergenic
1052053020 9:23870053-23870075 TACATAAACTTATGGTAATGGGG + Intergenic
1052307429 9:27026112-27026134 CACATAAACTTAAGGTAAAAGGG + Intronic
1052464465 9:28812935-28812957 TTCATAAACTTCAGTTATAGTGG - Intergenic
1052537328 9:29763425-29763447 CACATAAACTTAGAGTAAAGGGG + Intergenic
1052550071 9:29937070-29937092 CACATAAACTTAAGGTAAAAGGG - Intergenic
1052731270 9:32289417-32289439 CATATAAACTTAAAGTAAAGGGG - Intergenic
1053107071 9:35418964-35418986 TATATAAACTCAAGGTAAAGGGG + Intergenic
1053126753 9:35587291-35587313 CACATAAACTTAAGGTAAAGGGG + Intergenic
1053631294 9:39942749-39942771 CTCATAGACTCAAGGTAAGGGGG - Intergenic
1053774470 9:41520784-41520806 CTCATAGACTCAAGGTAAGGGGG + Intergenic
1054212593 9:62307949-62307971 CTCATAGACTCAAGGTAAGGGGG + Intergenic
1054844619 9:69780759-69780781 CACATAAACTTAAGGTAAAGGGG - Intergenic
1055125136 9:72710707-72710729 CACATAAAGTTGAGGTAAAAGGG - Intronic
1055138105 9:72846197-72846219 CACATAAACTTAAGGTAAAGGGG + Intergenic
1055156504 9:73068834-73068856 CACATAAACTTAAGGTAAACGGG + Intronic
1055186953 9:73468842-73468864 CACATAAACTTAGAGTAAAGGGG - Intergenic
1055244758 9:74226293-74226315 CACATAAACTTAAGGTAAAGAGG + Intergenic
1055846727 9:80573895-80573917 CACATAAACTTAAGGCAAATGGG + Intergenic
1055905600 9:81290626-81290648 CACATAAACTTAAAGAAAAAGGG - Intergenic
1056026875 9:82506901-82506923 CACATAAACTTAAGGTAAAGGGG + Intergenic
1056037356 9:82620689-82620711 CCCATCAAATTACGGTAAAGAGG - Intergenic
1056309633 9:85326303-85326325 CACATAAACTTAAGGTAAAGGGG + Intergenic
1056322531 9:85450249-85450271 CACATAAACTTAAAGTAGAGAGG - Intergenic
1056671869 9:88636914-88636936 CCTATAAACTTAAGATAAAAGGG - Intergenic
1056698842 9:88885265-88885287 CACATAAACTTAAAGTAAAGGGG - Intergenic
1056948266 9:91019599-91019621 CACATAAACTTAAGGTAAAGGGG + Intergenic
1057004022 9:91539826-91539848 CGCATAAACTTAAAGTAAAGGGG + Intergenic
1057119254 9:92556698-92556720 CACATACACTTAAAGTAAAGGGG - Intronic
1057340330 9:94195453-94195475 CATATAAACTCAAGGTAAAGGGG - Intergenic
1057475908 9:95401282-95401304 CACATAAACTTAAGGTAAAGGGG + Intergenic
1057999147 9:99847789-99847811 GTCATAAACTTCTAGTAAAGAGG + Intronic
1058540500 9:106007497-106007519 TGCACAAACTTAAGGTAAAGGGG - Intergenic
1059028462 9:110663116-110663138 CTCATTCACTTAAAGAAAAGTGG - Intergenic
1059032881 9:110719364-110719386 AACATAAACTTAAGGTAAAGGGG + Intronic
1059609383 9:115876480-115876502 CACATAAACTTAAAGTAAATGGG - Intergenic
1059977149 9:119729788-119729810 CTCAAAAAATTAATGCAAAGTGG - Intergenic
1060314261 9:122494546-122494568 CACATACACTTAAGGTAAAGGGG - Intergenic
1060375547 9:123112882-123112904 CTCAGAATATGAAGGTAAAGGGG - Intronic
1060460032 9:123843397-123843419 CTAACAAACATAAGGTACAGTGG - Intronic
1203609700 Un_KI270748v1:85836-85858 CACAAAAACTTAATGGAAAGAGG + Intergenic
1186910205 X:14155706-14155728 CTGATAAATCCAAGGTAAAGGGG - Intergenic
1187589049 X:20695430-20695452 CACATAAACTTAAGGTAAAGGGG + Intergenic
1187748577 X:22435394-22435416 CACATAAACTTAAAGTAAAGGGG + Intergenic
1188040325 X:25364458-25364480 CACACAAACTTAAGGTAAAGGGG - Intergenic
1188045688 X:25424214-25424236 TGCATAAACTTAAAGTAAAGGGG - Intergenic
1188389167 X:29598895-29598917 CACATAATCTTAAGGTAAAGGGG - Intronic
1188712532 X:33418173-33418195 CTTATAGACTGAAGGTAAAGGGG + Intergenic
1188719195 X:33502104-33502126 CACATAAACTTAAGGTAAAGAGG + Intergenic
1188956413 X:36439476-36439498 CATATAAACTTAAGGTAAAAGGG + Intergenic
1189218368 X:39346886-39346908 CACATAAACTTAAAGTAAAGGGG + Intergenic
1189599953 X:42613651-42613673 TACATAAACCTAAGGTAAAGAGG - Intergenic
1189603347 X:42650395-42650417 CATATAAACTTAAAGTAAAGGGG + Intergenic
1189639126 X:43048893-43048915 CACATAAACTTAAGGAAAAGGGG - Intergenic
1189663057 X:43324397-43324419 CACATAAACTTAAGGTAAAGGGG - Intergenic
1189878953 X:45469336-45469358 CACATAAACTTAAAGTAAGGGGG - Intergenic
1189945806 X:46177435-46177457 CACATAAACTTAAGGTAAAGGGG - Intergenic
1189962244 X:46334766-46334788 CACATAAACTTAAAGGAAAGGGG + Intergenic
1190449137 X:50560000-50560022 CACATAAACTTAAAGTAAAGGGG + Intergenic
1190631999 X:52397052-52397074 CGCACAAATTTGAGGTAAAGGGG - Intergenic
1191045514 X:56131761-56131783 CACATAAACTTAAGGTAAAAGGG + Intergenic
1191067504 X:56366293-56366315 CACATAAACTTAAAGTAAAGGGG - Intergenic
1191077105 X:56466937-56466959 CACAGAAACTTAAGGTAAAGGGG - Intergenic
1191179782 X:57548702-57548724 CACATAAATTTAAGGTAAAGGGG + Intergenic
1191741712 X:64442954-64442976 CATATAGACTTAAGGTAAAGGGG + Intergenic
1191787444 X:64932222-64932244 CATGTAAGCTTAAGGTAAAGGGG - Intronic
1191804949 X:65125833-65125855 CACATAAACTTAAGATAAAGGGG - Intergenic
1191806855 X:65145333-65145355 CACACAAACTTAAGGTAAAGGGG - Intergenic
1191819954 X:65294626-65294648 CACATAAAGTTAAGGTAAAGGGG + Intergenic
1191879498 X:65830660-65830682 TATATAAACTTAAGGTAAAGGGG + Intergenic
1191903382 X:66062542-66062564 CACATAAACTTAAAATAAAGGGG - Intergenic
1191909245 X:66130246-66130268 CATATAAACTTTAGGTAAAGGGG - Intergenic
1191913765 X:66179946-66179968 CACATAAACTTAAAGTCAAGGGG - Intronic
1191917422 X:66217812-66217834 CACATAAACTTAAGGTAAAAGGG + Intronic
1191945020 X:66524181-66524203 CACATAAACTTAAGGTAAAGGGG - Intergenic
1191965057 X:66749018-66749040 CACATAAACCTAAAGTAAAGAGG - Intergenic
1191970745 X:66813520-66813542 TACATAAAATTAAGGTAAAGGGG - Intergenic
1192009137 X:67249686-67249708 TGCATAAACTTAAGGTAAAAGGG + Intergenic
1192014428 X:67314143-67314165 CACATAAACTTAAAGTAAAGGGG - Intergenic
1192015706 X:67327711-67327733 CTCTTAAACGTAGGGTAAATTGG + Intergenic
1192021754 X:67400886-67400908 CACATAAACTTACAGTAAAGGGG - Intergenic
1192164167 X:68814845-68814867 CACAAAAACTTAAGGTAAAAGGG + Intergenic
1192319906 X:70082266-70082288 CTCTTAAACTTAAGGGACATCGG - Intergenic
1192512547 X:71731948-71731970 CTCAGAAACAGAAGGTAGAGTGG - Intergenic
1192514150 X:71749561-71749583 CTCAGAAACAGAAGGTAGAGTGG + Intergenic
1192526858 X:71854066-71854088 CTCAAAAACTGAAGGTAGAGTGG + Intergenic
1192609846 X:72556528-72556550 TACATAAACTGAAGGTAAAGGGG + Intronic
1192673827 X:73173890-73173912 TATATACACTTAAGGTAAAGGGG - Intergenic
1192688457 X:73333002-73333024 TACATAAACTTGAGGTAAAAGGG - Intergenic
1192869243 X:75170440-75170462 CACATAAACTTAAGATAAAGGGG - Intergenic
1192876816 X:75238256-75238278 CACATAAACTTAAGGTAAAGAGG + Intergenic
1192904761 X:75539509-75539531 CACATAAACATAAGGTAAAGGGG - Intergenic
1192913450 X:75630242-75630264 CACAAAAATTTAAAGTAAAGGGG - Intergenic
1192951068 X:76016647-76016669 CACATAAACTTGAGTTAAAAAGG + Intergenic
1192970095 X:76219470-76219492 CACAAAAACTTAAAGTAAAAGGG - Intergenic
1192978809 X:76316955-76316977 CTCATAAACTTAAAGTAAAAGGG - Intergenic
1192987015 X:76410572-76410594 CACATAAACTTAAGGTAAAAAGG + Intergenic
1192993791 X:76490757-76490779 CATATAAACTTAAGGTAAATAGG - Intergenic
1192994935 X:76503615-76503637 CACATAAACTTAGAGTAGAGGGG - Intergenic
1193062934 X:77225306-77225328 CACATATACTTAAGGTAAAGGGG + Intergenic
1193077213 X:77366822-77366844 CACATAAACTTAAAGTAAAGGGG + Intergenic
1193078149 X:77377123-77377145 CACATAAACTTAAGGTAAAGGGG + Intergenic
1193154864 X:78161158-78161180 TACATAAACTTAAAGTAAAGGGG + Intergenic
1193182568 X:78475713-78475735 CACATAAACTTAAGGTAAAAAGG - Intergenic
1193185725 X:78509764-78509786 CACATAAACTTAAGATAAAAGGG + Intergenic
1193203259 X:78717133-78717155 CAGACAAACTTAAGGTAAAGAGG + Intergenic
1193314867 X:80053233-80053255 CACATAAACTTAAGGTAAAGAGG - Intergenic
1193354571 X:80502511-80502533 CTTATAGACTCAAGGTAAAGGGG + Intergenic
1193366502 X:80639997-80640019 TACACAAACTTAAGGTAAAGTGG + Intergenic
1193405081 X:81090881-81090903 CATATAAACTTAAAGTAAAGGGG + Intergenic
1193415510 X:81218115-81218137 CATATGAACTTAAGGTAAAGGGG - Intronic
1193469724 X:81885656-81885678 CACATAAACTTAAAGGAAAGGGG - Intergenic
1193590158 X:83379594-83379616 CACATAAACTTAAAGTAAAGGGG - Intergenic
1193590889 X:83387497-83387519 CACAGAAACTTAAGGTAAAGGGG + Intergenic
1193618870 X:83725958-83725980 CACATAAACTTAAGGTAAAGGGG + Intergenic
1193632039 X:83901354-83901376 CACACAAACTTAAGGCAAAGGGG + Intergenic
1193721779 X:84995418-84995440 CACATAGACTGAAGGTAAAAGGG + Intergenic
1193723411 X:85014187-85014209 CACATATACTTAAGGTAAAGGGG - Intronic
1193785819 X:85758760-85758782 CACATACACTTAAGGTAAAGGGG - Intergenic
1193791830 X:85823670-85823692 CACACAAACTTAAGGTAAAGGGG + Intergenic
1193924635 X:87468381-87468403 CAAATAAACTTAATGTAAAGGGG + Intergenic
1193994540 X:88348260-88348282 CATATAAACTCAAAGTAAAGAGG + Intergenic
1194040113 X:88930338-88930360 CATATAAACTTCAAGTAAAGGGG - Intergenic
1194047759 X:89030618-89030640 CTTATAGACTCAAGGTAAATAGG - Intergenic
1194058588 X:89167611-89167633 CACATAAACTTAAGGTAAAGGGG + Intergenic
1194103424 X:89736695-89736717 CACAAAAACTTAAGGTAAAGGGG - Intergenic
1194144525 X:90246222-90246244 CATATAAACTCAAGGTAAAGGGG + Intergenic
1194168278 X:90549784-90549806 CACATTAACTTAAGGTAAAGGGG + Intergenic
1194181771 X:90718826-90718848 CACATAAACTTAAGGTAAAGGGG + Intergenic
1194183936 X:90748252-90748274 CAAATAAACTTAACATAAAGGGG - Intergenic
1194214142 X:91108057-91108079 CACATAAATGTAAGGTGAAGAGG - Intergenic
1194224724 X:91242730-91242752 CACATAAACTTAAGGTAAAGAGG - Intergenic
1194232160 X:91337575-91337597 CACATAAACTTAAGGTAAAGGGG + Intergenic
1194262882 X:91718660-91718682 CATATAAACTTAAGGTAATGGGG + Intergenic
1194278403 X:91915465-91915487 CACATAAACTTAAGGTAATGGGG + Intronic
1194354052 X:92858472-92858494 CACATGAACTTAAAGTAAAGGGG + Intergenic
1194470066 X:94283484-94283506 GACATAAACTTAAGGTAGAGGGG - Intergenic
1194543269 X:95201656-95201678 CACATAAACTTAAAATAAAAGGG - Intergenic
1194547478 X:95255864-95255886 CCCATAAACTTAAGATAAAGGGG - Intergenic
1194553969 X:95334867-95334889 CACAAAAACTTAAAGTAAATGGG + Intergenic
1194557074 X:95372811-95372833 CATATAAACTCAAGGTAAATGGG + Intergenic
1194606419 X:95984657-95984679 CACATAAACTTAAGGTAAAGGGG - Intergenic
1194630466 X:96276424-96276446 CACATAAACTTAAGGTAAAAGGG + Intergenic
1194882381 X:99270193-99270215 CACAGAAACTTAAAGTAAAGGGG - Intergenic
1194967542 X:100305695-100305717 CACATAAACTTAAGGTAAAGGGG + Intronic
1195019312 X:100810876-100810898 CACATAAACTTAAAATAAAGGGG - Intergenic
1195076262 X:101329762-101329784 CACATAAACTTAAGGTAAACAGG + Intergenic
1195231787 X:102857598-102857620 CATATAAACTTAAGGTAAAGGGG - Intergenic
1195818233 X:108911817-108911839 CACATAAACTTACGGTAAAAGGG + Intergenic
1195838471 X:109145926-109145948 CATGTAAACTTAAGGTAAAAAGG + Intergenic
1195972557 X:110489679-110489701 CATATAAACTTAAGGTAAAGGGG - Intergenic
1195984972 X:110619904-110619926 CACAAAAACTTAAGGTAAAGGGG - Intergenic
1196024196 X:111022813-111022835 CACATAAACTTAAGGTAAAGGGG + Intronic
1196149267 X:112354302-112354324 TTGAGAAACCTAAGGTAAAGAGG - Intergenic
1196161518 X:112489286-112489308 CACAGAAACTTAAAGTAAAGGGG + Intergenic
1196171092 X:112589342-112589364 CACATAAACTTAAAGTAAAGGGG + Intergenic
1196219093 X:113090191-113090213 CACATAAACTTAAAGTAAAGGGG + Intergenic
1196224976 X:113156089-113156111 CGCACAAACTTAAGGTAAAGGGG - Intergenic
1196484700 X:116192130-116192152 CACATAAACTTAAGGTGAAGGGG - Intergenic
1196599146 X:117582046-117582068 CATATAAACTCAAGGTAAAGGGG - Intergenic
1196737716 X:118994311-118994333 CACATAAACTTGAAGTAAAGGGG + Intronic
1196948018 X:120848138-120848160 CACACAAACTTAAGGTACAGGGG - Intergenic
1196994495 X:121366795-121366817 CACATAAGCTTAAGGTAAAGGGG - Intergenic
1197027905 X:121777584-121777606 CTTGTAGACTGAAGGTAAAGGGG - Intergenic
1197054455 X:122099563-122099585 CACATAAACTTAAGGTAAAGGGG - Intergenic
1197055306 X:122111887-122111909 CACATAAACTCAAGGCAAAGGGG - Intergenic
1197066037 X:122235456-122235478 CAAATAAACTTAAAGTAAATGGG - Intergenic
1197081556 X:122424604-122424626 CACATAAACTTAAGGTAAAGGGG - Intergenic
1197132647 X:123022267-123022289 TACATAAACTTAAAGTAAAGGGG + Intergenic
1197393112 X:125893465-125893487 CACATAAACTTAAAATAAAGGGG - Intergenic
1197463602 X:126773467-126773489 CACATAAACTTAAGGTAATGGGG + Intergenic
1197504107 X:127280193-127280215 CACATAAACTTAAGGTAAAGGGG + Intergenic
1197515350 X:127421267-127421289 CACATAAGCTTAAGGTAAAGGGG - Intergenic
1197519113 X:127475000-127475022 CACATAACCTTAAAGTAAAAGGG + Intergenic
1197545459 X:127818159-127818181 CACATAAACTTAAGGTAAAGGGG + Intergenic
1197552424 X:127909286-127909308 CATATAAACTCAAGTTAAAGAGG + Intergenic
1197556606 X:127963470-127963492 CACATAAACTTAATATAAAGGGG - Intergenic
1197571981 X:128161358-128161380 CACATAAACTTAAGGTAAAGGGG - Intergenic
1197604041 X:128563508-128563530 CACATAAACTTAACGTAAAGGGG + Intergenic
1197664414 X:129208572-129208594 CACATAAACTTAAGGTGAAGGGG - Intergenic
1197999112 X:132413474-132413496 CTAAGAATCTTAAGGTAAAGAGG - Intronic
1198559679 X:137836082-137836104 CACATAAACTTAAGGTAAAGGGG - Intergenic
1198583087 X:138088538-138088560 GACATAAACTTAAGGTAAATGGG + Intergenic
1198616644 X:138465131-138465153 CATATAAACTTAAGGTAAAGGGG + Intergenic
1198696056 X:139339541-139339563 CACATAAACTTAAGGTAAAGGGG - Intergenic
1198712667 X:139522832-139522854 CACATAAACTTAAGGTAAAGGGG + Intergenic
1198797081 X:140408775-140408797 CACATAAACTTAAGGTAAAGGGG - Intergenic
1198927832 X:141819446-141819468 CTGATAAAATAAAGCTAAAGAGG + Intergenic
1198943059 X:141980093-141980115 CACATAAACTTAAGATAAAGGGG - Intergenic
1199057638 X:143317237-143317259 CACATAAACTTAAAGTAAAGGGG - Intergenic
1199065760 X:143416349-143416371 CATATAAATTCAAGGTAAAGGGG - Intergenic
1199077406 X:143539904-143539926 CATATAAACTCAAGGTAAAGGGG + Intergenic
1199103470 X:143835015-143835037 TACATAAACATAAGCTAAAGAGG + Intergenic
1199132086 X:144201633-144201655 CCCATAAGCTCAAAGTAAAGGGG - Intergenic
1199241946 X:145557112-145557134 CCTATAAACTCAAGGGAAAGGGG + Intergenic
1199283579 X:146030897-146030919 CACATAAATTTAAGGTAAAAAGG + Intergenic
1199323125 X:146464149-146464171 CATATAAACTCAAGGTAAAGGGG - Intergenic
1199424392 X:147683867-147683889 CACACAAACTCAAAGTAAAGGGG + Intergenic
1199521305 X:148739496-148739518 CACATAAACTTCAAGTAAAGGGG - Intronic
1199587057 X:149425710-149425732 CACATAAACTTAAGGTATAGAGG + Intergenic
1199668747 X:150123086-150123108 CACATAAACTTAAAGTACAGAGG + Intergenic
1199732187 X:150646059-150646081 CAAATAAACTTTAGGTAAATAGG + Intronic
1199821541 X:151454054-151454076 CACATAAACCTAAAGTAAAGGGG + Intergenic
1199926523 X:152472148-152472170 CATAAAAACTTAAAGTAAAGGGG + Intergenic
1200317906 X:155153689-155153711 CACATCAACTTAAGGTAAAGGGG - Intergenic
1200490281 Y:3815527-3815549 CATATAAACTCAAGATAAAGGGG + Intergenic
1200514524 Y:4127564-4127586 CACATTAACTTAAGGTAAAGGGG + Intergenic
1200528394 Y:4300742-4300764 CACATAAACTTAAGGTAAAGGGG + Intergenic
1200561188 Y:4706040-4706062 CACATAAACTTAAGGTAAAGCGG - Intergenic
1200595738 Y:5137545-5137567 CACATAAACTTAAGGTAATGGGG + Intronic
1201307823 Y:12565920-12565942 CTCATAAACTTAAAGTAAAGAGG - Intergenic
1201408749 Y:13676103-13676125 CATAAAAACTTAAGGTAAATGGG + Intergenic
1201466817 Y:14290986-14291008 ATCATAAACTTAATAAAAAGAGG - Intergenic
1201544403 Y:15144925-15144947 ATCAAAAACTTAAGGAAAAATGG + Intergenic
1201934559 Y:19394182-19394204 CACATAAACTTAAAGTAAATGGG - Intergenic
1202036227 Y:20639438-20639460 CACATAAACTTAAGGTTAATGGG - Intergenic