ID: 1171378455

View in Genome Browser
Species Human (GRCh38)
Location 20:24713018-24713040
Sequence TCTCATAAACTTAAGGTAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171378455_1171378458 -9 Left 1171378455 20:24713018-24713040 CCCTTTACCTTAAGTTTATGAGA No data
Right 1171378458 20:24713032-24713054 TTTATGAGACCTTATATGTTAGG No data
1171378455_1171378462 24 Left 1171378455 20:24713018-24713040 CCCTTTACCTTAAGTTTATGAGA No data
Right 1171378462 20:24713065-24713087 AAAGGCAGCAGATACTTGGTTGG No data
1171378455_1171378460 6 Left 1171378455 20:24713018-24713040 CCCTTTACCTTAAGTTTATGAGA No data
Right 1171378460 20:24713047-24713069 ATGTTAGGCGAGTCTCTTAAAGG No data
1171378455_1171378461 20 Left 1171378455 20:24713018-24713040 CCCTTTACCTTAAGTTTATGAGA No data
Right 1171378461 20:24713061-24713083 TCTTAAAGGCAGCAGATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171378455 Original CRISPR TCTCATAAACTTAAGGTAAA GGG (reversed) Intergenic
No off target data available for this crispr