ID: 1171378457

View in Genome Browser
Species Human (GRCh38)
Location 20:24713025-24713047
Sequence TATAAGGTCTCATAAACTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171378457_1171378462 17 Left 1171378457 20:24713025-24713047 CCTTAAGTTTATGAGACCTTATA No data
Right 1171378462 20:24713065-24713087 AAAGGCAGCAGATACTTGGTTGG No data
1171378457_1171378461 13 Left 1171378457 20:24713025-24713047 CCTTAAGTTTATGAGACCTTATA No data
Right 1171378461 20:24713061-24713083 TCTTAAAGGCAGCAGATACTTGG No data
1171378457_1171378460 -1 Left 1171378457 20:24713025-24713047 CCTTAAGTTTATGAGACCTTATA No data
Right 1171378460 20:24713047-24713069 ATGTTAGGCGAGTCTCTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171378457 Original CRISPR TATAAGGTCTCATAAACTTA AGG (reversed) Intergenic
No off target data available for this crispr