ID: 1171378459

View in Genome Browser
Species Human (GRCh38)
Location 20:24713041-24713063
Sequence AGAGACTCGCCTAACATATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171378459_1171378462 1 Left 1171378459 20:24713041-24713063 CCTTATATGTTAGGCGAGTCTCT No data
Right 1171378462 20:24713065-24713087 AAAGGCAGCAGATACTTGGTTGG No data
1171378459_1171378461 -3 Left 1171378459 20:24713041-24713063 CCTTATATGTTAGGCGAGTCTCT No data
Right 1171378461 20:24713061-24713083 TCTTAAAGGCAGCAGATACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171378459 Original CRISPR AGAGACTCGCCTAACATATA AGG (reversed) Intergenic
No off target data available for this crispr