ID: 1171378462

View in Genome Browser
Species Human (GRCh38)
Location 20:24713065-24713087
Sequence AAAGGCAGCAGATACTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171378454_1171378462 25 Left 1171378454 20:24713017-24713039 CCCCTTTACCTTAAGTTTATGAG 0: 7
1: 277
2: 436
3: 355
4: 391
Right 1171378462 20:24713065-24713087 AAAGGCAGCAGATACTTGGTTGG No data
1171378457_1171378462 17 Left 1171378457 20:24713025-24713047 CCTTAAGTTTATGAGACCTTATA No data
Right 1171378462 20:24713065-24713087 AAAGGCAGCAGATACTTGGTTGG No data
1171378455_1171378462 24 Left 1171378455 20:24713018-24713040 CCCTTTACCTTAAGTTTATGAGA No data
Right 1171378462 20:24713065-24713087 AAAGGCAGCAGATACTTGGTTGG No data
1171378459_1171378462 1 Left 1171378459 20:24713041-24713063 CCTTATATGTTAGGCGAGTCTCT No data
Right 1171378462 20:24713065-24713087 AAAGGCAGCAGATACTTGGTTGG No data
1171378453_1171378462 28 Left 1171378453 20:24713014-24713036 CCACCCCTTTACCTTAAGTTTAT 0: 188
1: 446
2: 399
3: 274
4: 531
Right 1171378462 20:24713065-24713087 AAAGGCAGCAGATACTTGGTTGG No data
1171378456_1171378462 23 Left 1171378456 20:24713019-24713041 CCTTTACCTTAAGTTTATGAGAC No data
Right 1171378462 20:24713065-24713087 AAAGGCAGCAGATACTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171378462 Original CRISPR AAAGGCAGCAGATACTTGGT TGG Intergenic
No off target data available for this crispr