ID: 1171383531

View in Genome Browser
Species Human (GRCh38)
Location 20:24751744-24751766
Sequence TGATGCAGTAGGTGTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171383523_1171383531 19 Left 1171383523 20:24751702-24751724 CCACAGAGCTTGTGTGTTTCGGA No data
Right 1171383531 20:24751744-24751766 TGATGCAGTAGGTGTGAGCTGGG No data
1171383526_1171383531 -5 Left 1171383526 20:24751726-24751748 CCCTGCAGCCAGGGTTTCTGATG No data
Right 1171383531 20:24751744-24751766 TGATGCAGTAGGTGTGAGCTGGG No data
1171383521_1171383531 20 Left 1171383521 20:24751701-24751723 CCCACAGAGCTTGTGTGTTTCGG No data
Right 1171383531 20:24751744-24751766 TGATGCAGTAGGTGTGAGCTGGG No data
1171383527_1171383531 -6 Left 1171383527 20:24751727-24751749 CCTGCAGCCAGGGTTTCTGATGC No data
Right 1171383531 20:24751744-24751766 TGATGCAGTAGGTGTGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171383531 Original CRISPR TGATGCAGTAGGTGTGAGCT GGG Intergenic
No off target data available for this crispr