ID: 1171385082

View in Genome Browser
Species Human (GRCh38)
Location 20:24764438-24764460
Sequence CTGTGGGCTTGGAGGTCAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171385071_1171385082 25 Left 1171385071 20:24764390-24764412 CCATCTTGCGATGCTGTAGTCGA No data
Right 1171385082 20:24764438-24764460 CTGTGGGCTTGGAGGTCAGGCGG No data
1171385070_1171385082 26 Left 1171385070 20:24764389-24764411 CCCATCTTGCGATGCTGTAGTCG No data
Right 1171385082 20:24764438-24764460 CTGTGGGCTTGGAGGTCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171385082 Original CRISPR CTGTGGGCTTGGAGGTCAGG CGG Intergenic
No off target data available for this crispr