ID: 1171386789

View in Genome Browser
Species Human (GRCh38)
Location 20:24775005-24775027
Sequence AAAGCATAACAGACCCTGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171386787_1171386789 -3 Left 1171386787 20:24774985-24775007 CCTCATAGGTATTTGAGAAAAAA No data
Right 1171386789 20:24775005-24775027 AAAGCATAACAGACCCTGTAGGG No data
1171386785_1171386789 28 Left 1171386785 20:24774954-24774976 CCAAACTAGAAGGGGTAAAGAAG No data
Right 1171386789 20:24775005-24775027 AAAGCATAACAGACCCTGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171386789 Original CRISPR AAAGCATAACAGACCCTGTA GGG Intergenic
No off target data available for this crispr