ID: 1171388062 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 20:24783516-24783538 |
| Sequence | GGGAAGTCAGCTGCTGGGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1171388062_1171388070 | 1 | Left | 1171388062 | 20:24783516-24783538 | CCAGCCCCAGCAGCTGACTTCCC | No data | ||
| Right | 1171388070 | 20:24783540-24783562 | CCATCCACACAGGCCACCTCTGG | No data | ||||
| 1171388062_1171388066 | -9 | Left | 1171388062 | 20:24783516-24783538 | CCAGCCCCAGCAGCTGACTTCCC | No data | ||
| Right | 1171388066 | 20:24783530-24783552 | TGACTTCCCGCCATCCACACAGG | No data | ||||
| 1171388062_1171388072 | 8 | Left | 1171388062 | 20:24783516-24783538 | CCAGCCCCAGCAGCTGACTTCCC | No data | ||
| Right | 1171388072 | 20:24783547-24783569 | CACAGGCCACCTCTGGCAGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1171388062 | Original CRISPR | GGGAAGTCAGCTGCTGGGGC TGG (reversed) | Intergenic | ||