ID: 1171388062

View in Genome Browser
Species Human (GRCh38)
Location 20:24783516-24783538
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171388062_1171388070 1 Left 1171388062 20:24783516-24783538 CCAGCCCCAGCAGCTGACTTCCC No data
Right 1171388070 20:24783540-24783562 CCATCCACACAGGCCACCTCTGG No data
1171388062_1171388066 -9 Left 1171388062 20:24783516-24783538 CCAGCCCCAGCAGCTGACTTCCC No data
Right 1171388066 20:24783530-24783552 TGACTTCCCGCCATCCACACAGG No data
1171388062_1171388072 8 Left 1171388062 20:24783516-24783538 CCAGCCCCAGCAGCTGACTTCCC No data
Right 1171388072 20:24783547-24783569 CACAGGCCACCTCTGGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171388062 Original CRISPR GGGAAGTCAGCTGCTGGGGC TGG (reversed) Intergenic