ID: 1171388063

View in Genome Browser
Species Human (GRCh38)
Location 20:24783520-24783542
Sequence TGGCGGGAAGTCAGCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171388063_1171388072 4 Left 1171388063 20:24783520-24783542 CCCCAGCAGCTGACTTCCCGCCA No data
Right 1171388072 20:24783547-24783569 CACAGGCCACCTCTGGCAGAAGG No data
1171388063_1171388070 -3 Left 1171388063 20:24783520-24783542 CCCCAGCAGCTGACTTCCCGCCA No data
Right 1171388070 20:24783540-24783562 CCATCCACACAGGCCACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171388063 Original CRISPR TGGCGGGAAGTCAGCTGCTG GGG (reversed) Intergenic