ID: 1171388070

View in Genome Browser
Species Human (GRCh38)
Location 20:24783540-24783562
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171388063_1171388070 -3 Left 1171388063 20:24783520-24783542 CCCCAGCAGCTGACTTCCCGCCA No data
Right 1171388070 20:24783540-24783562 CCATCCACACAGGCCACCTCTGG No data
1171388064_1171388070 -4 Left 1171388064 20:24783521-24783543 CCCAGCAGCTGACTTCCCGCCAT No data
Right 1171388070 20:24783540-24783562 CCATCCACACAGGCCACCTCTGG No data
1171388061_1171388070 7 Left 1171388061 20:24783510-24783532 CCAACTCCAGCCCCAGCAGCTGA No data
Right 1171388070 20:24783540-24783562 CCATCCACACAGGCCACCTCTGG No data
1171388062_1171388070 1 Left 1171388062 20:24783516-24783538 CCAGCCCCAGCAGCTGACTTCCC No data
Right 1171388070 20:24783540-24783562 CCATCCACACAGGCCACCTCTGG No data
1171388065_1171388070 -5 Left 1171388065 20:24783522-24783544 CCAGCAGCTGACTTCCCGCCATC No data
Right 1171388070 20:24783540-24783562 CCATCCACACAGGCCACCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171388070 Original CRISPR CCATCCACACAGGCCACCTC TGG Intergenic
No off target data available for this crispr