ID: 1171392914

View in Genome Browser
Species Human (GRCh38)
Location 20:24812461-24812483
Sequence TGGGGTGGCATGGGAGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171392914_1171392927 12 Left 1171392914 20:24812461-24812483 CCAGCAGCTCCCATGCCACCCCA No data
Right 1171392927 20:24812496-24812518 GGTCACAGTGACCTTTGTCTGGG No data
1171392914_1171392926 11 Left 1171392914 20:24812461-24812483 CCAGCAGCTCCCATGCCACCCCA No data
Right 1171392926 20:24812495-24812517 GGGTCACAGTGACCTTTGTCTGG No data
1171392914_1171392917 -10 Left 1171392914 20:24812461-24812483 CCAGCAGCTCCCATGCCACCCCA No data
Right 1171392917 20:24812474-24812496 TGCCACCCCACCCTCTTGCCTGG No data
1171392914_1171392928 13 Left 1171392914 20:24812461-24812483 CCAGCAGCTCCCATGCCACCCCA No data
Right 1171392928 20:24812497-24812519 GTCACAGTGACCTTTGTCTGGGG No data
1171392914_1171392918 -9 Left 1171392914 20:24812461-24812483 CCAGCAGCTCCCATGCCACCCCA No data
Right 1171392918 20:24812475-24812497 GCCACCCCACCCTCTTGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171392914 Original CRISPR TGGGGTGGCATGGGAGCTGC TGG (reversed) Intergenic
No off target data available for this crispr