ID: 1171393023

View in Genome Browser
Species Human (GRCh38)
Location 20:24813617-24813639
Sequence ATGGCTGAGGGCTCTTCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171393023_1171393030 3 Left 1171393023 20:24813617-24813639 CCAGCAGAAGAGCCCTCAGCCAT No data
Right 1171393030 20:24813643-24813665 AGGGCTAGCCAGCCTTCCAGAGG No data
1171393023_1171393034 25 Left 1171393023 20:24813617-24813639 CCAGCAGAAGAGCCCTCAGCCAT No data
Right 1171393034 20:24813665-24813687 GAGCCTGTCCCCTGCTCTCCTGG No data
1171393023_1171393036 27 Left 1171393023 20:24813617-24813639 CCAGCAGAAGAGCCCTCAGCCAT No data
Right 1171393036 20:24813667-24813689 GCCTGTCCCCTGCTCTCCTGGGG No data
1171393023_1171393035 26 Left 1171393023 20:24813617-24813639 CCAGCAGAAGAGCCCTCAGCCAT No data
Right 1171393035 20:24813666-24813688 AGCCTGTCCCCTGCTCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171393023 Original CRISPR ATGGCTGAGGGCTCTTCTGC TGG (reversed) Intergenic
No off target data available for this crispr