ID: 1171393412

View in Genome Browser
Species Human (GRCh38)
Location 20:24815795-24815817
Sequence TAGGATACAAAACAAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171393412_1171393417 0 Left 1171393412 20:24815795-24815817 CCTGGCTCTTGTTTTGTATCCTA No data
Right 1171393417 20:24815818-24815840 GGAAGGTCACATGTTCTTTAGGG No data
1171393412_1171393419 27 Left 1171393412 20:24815795-24815817 CCTGGCTCTTGTTTTGTATCCTA No data
Right 1171393419 20:24815845-24815867 CATTACCCACGCTCTCCCCAGGG No data
1171393412_1171393420 30 Left 1171393412 20:24815795-24815817 CCTGGCTCTTGTTTTGTATCCTA No data
Right 1171393420 20:24815848-24815870 TACCCACGCTCTCCCCAGGGTGG No data
1171393412_1171393416 -1 Left 1171393412 20:24815795-24815817 CCTGGCTCTTGTTTTGTATCCTA No data
Right 1171393416 20:24815817-24815839 AGGAAGGTCACATGTTCTTTAGG No data
1171393412_1171393418 26 Left 1171393412 20:24815795-24815817 CCTGGCTCTTGTTTTGTATCCTA No data
Right 1171393418 20:24815844-24815866 TCATTACCCACGCTCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171393412 Original CRISPR TAGGATACAAAACAAGAGCC AGG (reversed) Intergenic
No off target data available for this crispr