ID: 1171394158

View in Genome Browser
Species Human (GRCh38)
Location 20:24820264-24820286
Sequence CTGTAAACACTGATGCCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171394152_1171394158 14 Left 1171394152 20:24820227-24820249 CCCCACATAAAAGTCCTATGAAC No data
Right 1171394158 20:24820264-24820286 CTGTAAACACTGATGCCACTTGG No data
1171394149_1171394158 21 Left 1171394149 20:24820220-24820242 CCACCACCCCCACATAAAAGTCC No data
Right 1171394158 20:24820264-24820286 CTGTAAACACTGATGCCACTTGG No data
1171394154_1171394158 12 Left 1171394154 20:24820229-24820251 CCACATAAAAGTCCTATGAACAG No data
Right 1171394158 20:24820264-24820286 CTGTAAACACTGATGCCACTTGG No data
1171394156_1171394158 0 Left 1171394156 20:24820241-24820263 CCTATGAACAGGAAGCCAGTGCA No data
Right 1171394158 20:24820264-24820286 CTGTAAACACTGATGCCACTTGG No data
1171394153_1171394158 13 Left 1171394153 20:24820228-24820250 CCCACATAAAAGTCCTATGAACA No data
Right 1171394158 20:24820264-24820286 CTGTAAACACTGATGCCACTTGG No data
1171394150_1171394158 18 Left 1171394150 20:24820223-24820245 CCACCCCCACATAAAAGTCCTAT No data
Right 1171394158 20:24820264-24820286 CTGTAAACACTGATGCCACTTGG No data
1171394151_1171394158 15 Left 1171394151 20:24820226-24820248 CCCCCACATAAAAGTCCTATGAA No data
Right 1171394158 20:24820264-24820286 CTGTAAACACTGATGCCACTTGG No data
1171394148_1171394158 26 Left 1171394148 20:24820215-24820237 CCTTGCCACCACCCCCACATAAA No data
Right 1171394158 20:24820264-24820286 CTGTAAACACTGATGCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171394158 Original CRISPR CTGTAAACACTGATGCCACT TGG Intergenic
No off target data available for this crispr