ID: 1171394681

View in Genome Browser
Species Human (GRCh38)
Location 20:24824311-24824333
Sequence GCTGATGGGGAGCCACTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171394669_1171394681 17 Left 1171394669 20:24824271-24824293 CCTCCCCACAGGCGGGAGCAGCC No data
Right 1171394681 20:24824311-24824333 GCTGATGGGGAGCCACTGTGTGG No data
1171394668_1171394681 18 Left 1171394668 20:24824270-24824292 CCCTCCCCACAGGCGGGAGCAGC No data
Right 1171394681 20:24824311-24824333 GCTGATGGGGAGCCACTGTGTGG No data
1171394676_1171394681 -7 Left 1171394676 20:24824295-24824317 CCAATAGGCTCCAGAGGCTGATG No data
Right 1171394681 20:24824311-24824333 GCTGATGGGGAGCCACTGTGTGG No data
1171394671_1171394681 13 Left 1171394671 20:24824275-24824297 CCCACAGGCGGGAGCAGCCACCA No data
Right 1171394681 20:24824311-24824333 GCTGATGGGGAGCCACTGTGTGG No data
1171394670_1171394681 14 Left 1171394670 20:24824274-24824296 CCCCACAGGCGGGAGCAGCCACC No data
Right 1171394681 20:24824311-24824333 GCTGATGGGGAGCCACTGTGTGG No data
1171394667_1171394681 19 Left 1171394667 20:24824269-24824291 CCCCTCCCCACAGGCGGGAGCAG No data
Right 1171394681 20:24824311-24824333 GCTGATGGGGAGCCACTGTGTGG No data
1171394675_1171394681 -4 Left 1171394675 20:24824292-24824314 CCACCAATAGGCTCCAGAGGCTG No data
Right 1171394681 20:24824311-24824333 GCTGATGGGGAGCCACTGTGTGG No data
1171394672_1171394681 12 Left 1171394672 20:24824276-24824298 CCACAGGCGGGAGCAGCCACCAA No data
Right 1171394681 20:24824311-24824333 GCTGATGGGGAGCCACTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171394681 Original CRISPR GCTGATGGGGAGCCACTGTG TGG Intergenic
No off target data available for this crispr