ID: 1171396209

View in Genome Browser
Species Human (GRCh38)
Location 20:24835417-24835439
Sequence GGAGCCAGCAGTTGGGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171396209_1171396225 29 Left 1171396209 20:24835417-24835439 CCACTGTCCCAACTGCTGGCTCC No data
Right 1171396225 20:24835469-24835491 AGACAGGAGAGAGGTTGGCAGGG No data
1171396209_1171396223 24 Left 1171396209 20:24835417-24835439 CCACTGTCCCAACTGCTGGCTCC No data
Right 1171396223 20:24835464-24835486 CAGTGAGACAGGAGAGAGGTTGG No data
1171396209_1171396221 20 Left 1171396209 20:24835417-24835439 CCACTGTCCCAACTGCTGGCTCC No data
Right 1171396221 20:24835460-24835482 GATCCAGTGAGACAGGAGAGAGG No data
1171396209_1171396224 28 Left 1171396209 20:24835417-24835439 CCACTGTCCCAACTGCTGGCTCC No data
Right 1171396224 20:24835468-24835490 GAGACAGGAGAGAGGTTGGCAGG No data
1171396209_1171396219 13 Left 1171396209 20:24835417-24835439 CCACTGTCCCAACTGCTGGCTCC No data
Right 1171396219 20:24835453-24835475 TCACCATGATCCAGTGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171396209 Original CRISPR GGAGCCAGCAGTTGGGACAG TGG (reversed) Intergenic
No off target data available for this crispr