ID: 1171396214

View in Genome Browser
Species Human (GRCh38)
Location 20:24835438-24835460
Sequence CATGGTGAAGGGCCGGGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171396214_1171396223 3 Left 1171396214 20:24835438-24835460 CCAGGACCCGGCCCTTCACCATG No data
Right 1171396223 20:24835464-24835486 CAGTGAGACAGGAGAGAGGTTGG No data
1171396214_1171396229 29 Left 1171396214 20:24835438-24835460 CCAGGACCCGGCCCTTCACCATG No data
Right 1171396229 20:24835490-24835512 GGTTGAACGGAGGTAGGAAAAGG No data
1171396214_1171396227 19 Left 1171396214 20:24835438-24835460 CCAGGACCCGGCCCTTCACCATG No data
Right 1171396227 20:24835480-24835502 AGGTTGGCAGGGTTGAACGGAGG No data
1171396214_1171396226 16 Left 1171396214 20:24835438-24835460 CCAGGACCCGGCCCTTCACCATG No data
Right 1171396226 20:24835477-24835499 GAGAGGTTGGCAGGGTTGAACGG No data
1171396214_1171396225 8 Left 1171396214 20:24835438-24835460 CCAGGACCCGGCCCTTCACCATG No data
Right 1171396225 20:24835469-24835491 AGACAGGAGAGAGGTTGGCAGGG No data
1171396214_1171396219 -8 Left 1171396214 20:24835438-24835460 CCAGGACCCGGCCCTTCACCATG No data
Right 1171396219 20:24835453-24835475 TCACCATGATCCAGTGAGACAGG No data
1171396214_1171396221 -1 Left 1171396214 20:24835438-24835460 CCAGGACCCGGCCCTTCACCATG No data
Right 1171396221 20:24835460-24835482 GATCCAGTGAGACAGGAGAGAGG No data
1171396214_1171396228 23 Left 1171396214 20:24835438-24835460 CCAGGACCCGGCCCTTCACCATG No data
Right 1171396228 20:24835484-24835506 TGGCAGGGTTGAACGGAGGTAGG No data
1171396214_1171396224 7 Left 1171396214 20:24835438-24835460 CCAGGACCCGGCCCTTCACCATG No data
Right 1171396224 20:24835468-24835490 GAGACAGGAGAGAGGTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171396214 Original CRISPR CATGGTGAAGGGCCGGGTCC TGG (reversed) Intergenic
No off target data available for this crispr