ID: 1171396215

View in Genome Browser
Species Human (GRCh38)
Location 20:24835444-24835466
Sequence CTGGATCATGGTGAAGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171396215_1171396226 10 Left 1171396215 20:24835444-24835466 CCCGGCCCTTCACCATGATCCAG No data
Right 1171396226 20:24835477-24835499 GAGAGGTTGGCAGGGTTGAACGG No data
1171396215_1171396227 13 Left 1171396215 20:24835444-24835466 CCCGGCCCTTCACCATGATCCAG No data
Right 1171396227 20:24835480-24835502 AGGTTGGCAGGGTTGAACGGAGG No data
1171396215_1171396228 17 Left 1171396215 20:24835444-24835466 CCCGGCCCTTCACCATGATCCAG No data
Right 1171396228 20:24835484-24835506 TGGCAGGGTTGAACGGAGGTAGG No data
1171396215_1171396230 30 Left 1171396215 20:24835444-24835466 CCCGGCCCTTCACCATGATCCAG No data
Right 1171396230 20:24835497-24835519 CGGAGGTAGGAAAAGGAGCGAGG No data
1171396215_1171396225 2 Left 1171396215 20:24835444-24835466 CCCGGCCCTTCACCATGATCCAG No data
Right 1171396225 20:24835469-24835491 AGACAGGAGAGAGGTTGGCAGGG No data
1171396215_1171396223 -3 Left 1171396215 20:24835444-24835466 CCCGGCCCTTCACCATGATCCAG No data
Right 1171396223 20:24835464-24835486 CAGTGAGACAGGAGAGAGGTTGG No data
1171396215_1171396229 23 Left 1171396215 20:24835444-24835466 CCCGGCCCTTCACCATGATCCAG No data
Right 1171396229 20:24835490-24835512 GGTTGAACGGAGGTAGGAAAAGG No data
1171396215_1171396221 -7 Left 1171396215 20:24835444-24835466 CCCGGCCCTTCACCATGATCCAG No data
Right 1171396221 20:24835460-24835482 GATCCAGTGAGACAGGAGAGAGG No data
1171396215_1171396224 1 Left 1171396215 20:24835444-24835466 CCCGGCCCTTCACCATGATCCAG No data
Right 1171396224 20:24835468-24835490 GAGACAGGAGAGAGGTTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171396215 Original CRISPR CTGGATCATGGTGAAGGGCC GGG (reversed) Intergenic
No off target data available for this crispr