ID: 1171396217

View in Genome Browser
Species Human (GRCh38)
Location 20:24835449-24835471
Sequence TCTCACTGGATCATGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171396217_1171396228 12 Left 1171396217 20:24835449-24835471 CCCTTCACCATGATCCAGTGAGA No data
Right 1171396228 20:24835484-24835506 TGGCAGGGTTGAACGGAGGTAGG No data
1171396217_1171396232 29 Left 1171396217 20:24835449-24835471 CCCTTCACCATGATCCAGTGAGA No data
Right 1171396232 20:24835501-24835523 GGTAGGAAAAGGAGCGAGGAGGG No data
1171396217_1171396225 -3 Left 1171396217 20:24835449-24835471 CCCTTCACCATGATCCAGTGAGA No data
Right 1171396225 20:24835469-24835491 AGACAGGAGAGAGGTTGGCAGGG No data
1171396217_1171396223 -8 Left 1171396217 20:24835449-24835471 CCCTTCACCATGATCCAGTGAGA No data
Right 1171396223 20:24835464-24835486 CAGTGAGACAGGAGAGAGGTTGG No data
1171396217_1171396226 5 Left 1171396217 20:24835449-24835471 CCCTTCACCATGATCCAGTGAGA No data
Right 1171396226 20:24835477-24835499 GAGAGGTTGGCAGGGTTGAACGG No data
1171396217_1171396227 8 Left 1171396217 20:24835449-24835471 CCCTTCACCATGATCCAGTGAGA No data
Right 1171396227 20:24835480-24835502 AGGTTGGCAGGGTTGAACGGAGG No data
1171396217_1171396231 28 Left 1171396217 20:24835449-24835471 CCCTTCACCATGATCCAGTGAGA No data
Right 1171396231 20:24835500-24835522 AGGTAGGAAAAGGAGCGAGGAGG No data
1171396217_1171396224 -4 Left 1171396217 20:24835449-24835471 CCCTTCACCATGATCCAGTGAGA No data
Right 1171396224 20:24835468-24835490 GAGACAGGAGAGAGGTTGGCAGG No data
1171396217_1171396230 25 Left 1171396217 20:24835449-24835471 CCCTTCACCATGATCCAGTGAGA No data
Right 1171396230 20:24835497-24835519 CGGAGGTAGGAAAAGGAGCGAGG No data
1171396217_1171396229 18 Left 1171396217 20:24835449-24835471 CCCTTCACCATGATCCAGTGAGA No data
Right 1171396229 20:24835490-24835512 GGTTGAACGGAGGTAGGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171396217 Original CRISPR TCTCACTGGATCATGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr