ID: 1171396222

View in Genome Browser
Species Human (GRCh38)
Location 20:24835463-24835485
Sequence CAACCTCTCTCCTGTCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1171396222_1171396234 25 Left 1171396222 20:24835463-24835485 CCAGTGAGACAGGAGAGAGGTTG No data
Right 1171396234 20:24835511-24835533 GGAGCGAGGAGGGCAGGAGATGG No data
1171396222_1171396231 14 Left 1171396222 20:24835463-24835485 CCAGTGAGACAGGAGAGAGGTTG No data
Right 1171396231 20:24835500-24835522 AGGTAGGAAAAGGAGCGAGGAGG No data
1171396222_1171396236 27 Left 1171396222 20:24835463-24835485 CCAGTGAGACAGGAGAGAGGTTG No data
Right 1171396236 20:24835513-24835535 AGCGAGGAGGGCAGGAGATGGGG No data
1171396222_1171396233 19 Left 1171396222 20:24835463-24835485 CCAGTGAGACAGGAGAGAGGTTG No data
Right 1171396233 20:24835505-24835527 GGAAAAGGAGCGAGGAGGGCAGG No data
1171396222_1171396230 11 Left 1171396222 20:24835463-24835485 CCAGTGAGACAGGAGAGAGGTTG No data
Right 1171396230 20:24835497-24835519 CGGAGGTAGGAAAAGGAGCGAGG No data
1171396222_1171396226 -9 Left 1171396222 20:24835463-24835485 CCAGTGAGACAGGAGAGAGGTTG No data
Right 1171396226 20:24835477-24835499 GAGAGGTTGGCAGGGTTGAACGG No data
1171396222_1171396229 4 Left 1171396222 20:24835463-24835485 CCAGTGAGACAGGAGAGAGGTTG No data
Right 1171396229 20:24835490-24835512 GGTTGAACGGAGGTAGGAAAAGG No data
1171396222_1171396227 -6 Left 1171396222 20:24835463-24835485 CCAGTGAGACAGGAGAGAGGTTG No data
Right 1171396227 20:24835480-24835502 AGGTTGGCAGGGTTGAACGGAGG No data
1171396222_1171396228 -2 Left 1171396222 20:24835463-24835485 CCAGTGAGACAGGAGAGAGGTTG No data
Right 1171396228 20:24835484-24835506 TGGCAGGGTTGAACGGAGGTAGG No data
1171396222_1171396232 15 Left 1171396222 20:24835463-24835485 CCAGTGAGACAGGAGAGAGGTTG No data
Right 1171396232 20:24835501-24835523 GGTAGGAAAAGGAGCGAGGAGGG No data
1171396222_1171396235 26 Left 1171396222 20:24835463-24835485 CCAGTGAGACAGGAGAGAGGTTG No data
Right 1171396235 20:24835512-24835534 GAGCGAGGAGGGCAGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1171396222 Original CRISPR CAACCTCTCTCCTGTCTCAC TGG (reversed) Intergenic
No off target data available for this crispr